ZFIN is now using GRCz12tu for Genomic Data
miRNA Gene
mir196c
- ID
- ZDB-MIRNAG-050712-1
- Name
- microRNA 196c
- Symbol
- mir196c Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 11 Mapping Details/Browsers
- Genome Assembly
- GRCz12tu
- Annotation Status
- Current
- Description
- Predicted to enable mRNA regulatory element binding translation repressor activity. Predicted to act upstream of or within miRNA-mediated gene silencing by inhibition of translation and miRNA-mediated gene silencing by mRNA destabilization. Is expressed in neural tube and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).
- Genome Resources
- Note
-
Predicted Stem-Loop Sequence:
5' - AGCUGAUGCGUGGUUUAGGUAGUUUGAUGUUGUUGGGGUUGACUUCCUGGCUCGACAACAAGAAACUGCCUUGAUUACGUCAGUU - 3' (1) - Comparative Information
-
- All Expression Data
- 1 figure from He et al., 2011
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- No data available
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
---|---|---|---|---|---|
mRNA |
mir196c-201
(1)
|
Ensembl | 110 nt | ||
miRNA | mir196a.2b-001 | 22 nt |
Interactions and Pathways
No data available
Plasmids
No data available
- Genome Browsers