ZFIN is now using GRCz12tu for Genomic Data
miRNA Gene
mir196a-1
- ID
- ZDB-MIRNAG-041217-14
- Name
- microRNA 196a-1
- Symbol
- mir196a-1 Nomenclature History
- Previous Names
- Type
- miRNA_gene
- Location
- Chr: 23 Mapping Details/Browsers
- Genome Assembly
- GRCz12tu
- Annotation Status
- Current
- Description
- Predicted to enable mRNA regulatory element binding translation repressor activity. Acts upstream of or within miRNA-mediated post-transcriptional gene silencing and pectoral fin development. Is expressed in central nervous system; neural tube; pronephric duct; and tail bud. Human ortholog(s) of this gene implicated in hepatocellular carcinoma. Orthologous to human MIR196A2 (microRNA 196a-2).
- Genome Resources
- Note
-
Predicted Stem-Loop Sequence:
5' - GGCUGGUGCGUGGUUUAGGUAGUUUCAUGUUGUUGGGAUUGGCUUCCUGGCUCGACAACAAGAAACUGCCUUGAUUACGUCAGUUCGUC - 3' (1) - Comparative Information
-
- All Expression Data
- 2 figures from 2 publications
- Cross-Species Comparison
- High Throughput Data
- Thisse Expression Data
- No data available
Wild Type Expression Summary
- All Phenotype Data
- 6 figures from Yuan et al., 2023
- Cross-Species Comparison
- Alliance
Phenotype Summary
Mutations
Human Disease
Domain, Family, and Site Summary
No data available
Domain Details Per Protein
No data available
- Genome Browsers
Type | Name | Annotation Method | Has Havana Data | Length (nt) | Analysis |
---|---|---|---|---|---|
mRNA |
mir196a-1-201
(1)
|
Ensembl | 106 nt | ||
miRNA | mir196a-001 (1) | 22 nt |
Interactions and Pathways
No data available
Plasmids
No data available
- Genome Browsers