IMAGE

Fig. S3

ID
ZDB-IMAGE-180611-5
Publication
Eckerle et al., 2017 - Progesterone modulates microtubule dynamics and epiboly progression during zebrafish gastrulation
All Figures
Figures for Eckerle et al., 2017
Image
Figure Caption

Fig. S3

Live phenotypes of progesterone or pregnenolone treated wild-type embryos and effects of reduction of pregnenolone level by MO1-cyp11a1 injection on epiboly and microtubules

(a) Overview images show groups of live treated embryos at age when wild-type siblings reached 75% epiboly. Progesterone experiment (upper row): DMSO 1% control or indicated progesterone concentrations; 75 μM and 100 μM progesterone treated embryos arrested gastrulation at 30-40% epiboly and disintegrated. pregnenolone experiment (lower row): DMSO (2.5%) control or indicated pregnenolone concentrations. Embryos were indistinguishable from controls at all pregnenolone concentrations. Scale bar 500 μm.

(b) Images of single live wild-type embryos from experiment shown in (a) at age when untreated wildtype siblings reached 90% epiboly. Arrowheads mark blastoderm margin. Lateral view, animal to the top, scale bar 500 μm.

(c, d) MO1-cyp11a1 injection reduced the pregnenolone level in embryos at sphere and 60% epiboly compared to stCoMO injection. Pregnenolone levels were measured by ELISA in wild-type (c) or MZspg (d) embryonic lysates (n=1).

(e) Quantification of epiboly progression when control injected wild-type embryos reached 70% epiboly. stCoMO injections: wild-type: grey bar, n = 10, MZspg: red bar, n = 23. MO1-cyp11a1 injections: wild-type: green bar, n = 11; MZspg: green bar, n = 17. Error bars indicate SD. Epiboly progression of MO1-cyp11a1 injected embryos was significantly delayed compared to controls (p < 0.005, Mann-Whitney test).

(f) We confirmed MO1-cyp11a1 functionality by knock-down of GFP reporter expression. Specificity and efficiency of MO1-cyp11a1 against the translation start side of cyp11a1 has been tested by coinjection of a pCS2+ GFP reporter construct, which harbors the cyp11a1 morpholino target sequence (AAGTAGAGAGAGAGAGTGTGATGGC) in frame fused to ATG-deleted GFP coding sequence. The GFP-reporter and, serving as control, EB3-mCherry mRNAs (50 pg/embryos each) were injected without morpholino (left column), with stCoMO (4 ng/embryo, middle column), or with MO1- cyp11a1 (4 ng/embryo, right column). Fluorescence (GFP: middle row; dsRed: lower row) was examined at epiboly stages. GFP reporter expression was eliminated upon co-injection of MO1- cyp11a1, but not in controls, while EB3-mCherry fluorescence was present in all samples.

(g) Quantification of average EB3-mCherry track number at 40% and 60% epiboly for stCoMO, or MO1-cyp11a1 injected wild-type embryos. Error bars indicate SD (40% epiboly: stCoMO n = 16 MO1-cyp11a1 n = 18; 60% epiboly: stCoMO n = 15 MO1-cyp11a1 n = 15). Mann-Whitney test: differences NS.

Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image.

Reprinted from Developmental Biology, 434(2), Eckerle, S., Ringler, M., Lecaudey, V., Nitschke, R., Driever, W., Progesterone modulates microtubule dynamics and epiboly progression during zebrafish gastrulation, 249-266, Copyright (2017) with permission from Elsevier. Full text @ Dev. Biol.