Fig. S3
Live phenotypes of progesterone or pregnenolone treated wild-type embryos and effects of reduction of pregnenolone level by MO1-cyp11a1 injection on epiboly and microtubules
(a) Overview images show groups of live treated embryos at age when wild-type siblings reached 75% epiboly. Progesterone experiment (upper row): DMSO 1% control or indicated progesterone concentrations; 75 ?M and 100 ?M progesterone treated embryos arrested gastrulation at 30-40% epiboly and disintegrated. pregnenolone experiment (lower row): DMSO (2.5%) control or indicated pregnenolone concentrations. Embryos were indistinguishable from controls at all pregnenolone concentrations. Scale bar 500 ?m.
(b) Images of single live wild-type embryos from experiment shown in (a) at age when untreated wildtype siblings reached 90% epiboly. Arrowheads mark blastoderm margin. Lateral view, animal to the top, scale bar 500 ?m.
(c, d) MO1-cyp11a1 injection reduced the pregnenolone level in embryos at sphere and 60% epiboly compared to stCoMO injection. Pregnenolone levels were measured by ELISA in wild-type (c) or MZspg (d) embryonic lysates (n=1).
(e) Quantification of epiboly progression when control injected wild-type embryos reached 70% epiboly. stCoMO injections: wild-type: grey bar, n = 10, MZspg: red bar, n = 23. MO1-cyp11a1 injections: wild-type: green bar, n = 11; MZspg: green bar, n = 17. Error bars indicate SD. Epiboly progression of MO1-cyp11a1 injected embryos was significantly delayed compared to controls (p < 0.005, Mann-Whitney test).
(f) We confirmed MO1-cyp11a1 functionality by knock-down of GFP reporter expression. Specificity and efficiency of MO1-cyp11a1 against the translation start side of cyp11a1 has been tested by coinjection of a pCS2+ GFP reporter construct, which harbors the cyp11a1 morpholino target sequence (AAGTAGAGAGAGAGAGTGTGATGGC) in frame fused to ATG-deleted GFP coding sequence. The GFP-reporter and, serving as control, EB3-mCherry mRNAs (50 pg/embryos each) were injected without morpholino (left column), with stCoMO (4 ng/embryo, middle column), or with MO1- cyp11a1 (4 ng/embryo, right column). Fluorescence (GFP: middle row; dsRed: lower row) was examined at epiboly stages. GFP reporter expression was eliminated upon co-injection of MO1- cyp11a1, but not in controls, while EB3-mCherry fluorescence was present in all samples.
(g) Quantification of average EB3-mCherry track number at 40% and 60% epiboly for stCoMO, or MO1-cyp11a1 injected wild-type embryos. Error bars indicate SD (40% epiboly: stCoMO n = 16 MO1-cyp11a1 n = 18; 60% epiboly: stCoMO n = 15 MO1-cyp11a1 n = 15). Mann-Whitney test: differences NS.
Reprinted from Developmental Biology, 434(2), Eckerle, S., Ringler, M., Lecaudey, V., Nitschke, R., Driever, W., Progesterone modulates microtubule dynamics and epiboly progression during zebrafish gastrulation, 249-266, Copyright (2017) with permission from Elsevier. Full text @ Dev. Biol.