Fig. S1
- ID
- ZDB-IMAGE-120316-62
- Publication
- Bisgrove et al., 2012 - RFX2 is essential in the ciliated organ of asymmetry and an RFX2 transgene identifies a population of ciliated cells sufficient for fluid flow
- All Figures
- Figures for Bisgrove et al., 2012
Fig. S1 RT-PCR of cDNA prepared from total RNA extracted from bud stage un-injected zebrafish embryos and rfx2 SBMO injected embryos. Injection of 8 ng of rfx2 SBMO causes loss of the 170 bp wild-type rfx2 product (compare lanes 1 and 2) and retention of the intron separating exon 2 (the first coding exon) and exon 3. Much of the intron-containing product undergoes splicing at a cryptic splice donor site 369 bp into the intron (lane 2) while some remains unspliced (lane 4) and reads through this site to (and beyond) the Intron 2R primer located at 1270 bp into the intron. PCR products retaining the entire second intron are recovered using extended elongation times with the Exon2L/Exon3R primer pair (not shown). Lanes 5, 6 β-actin loading controls. Primers: Exon 2 L: (52 – GTCAGAAGGGGGCTCAGAGA-32); Intron 2R: (52- TCTAGCAGTGTGGCCGGTAT); Exon 3R; (52- TGTTGCACTCTAGGCACTGG-32).
Reprinted from Developmental Biology, 363(1), Bisgrove, B.W., Makova, S., Yost, H.J., and Brueckner, M., RFX2 is essential in the ciliated organ of asymmetry and an RFX2 transgene identifies a population of ciliated cells sufficient for fluid flow, 166-178, Copyright (2012) with permission from Elsevier. Full text @ Dev. Biol.