header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-051103-18
EST Name: eu61
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1611
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer GAGGAGTATCTGGCCCAAC
reverse_primer GGATCCATTAACCCTCACTAAAGGGAAAGATAATGCCCGATTCAAAG
Quality: Rating 4 ( Nice strong expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (10 images) from Thisse et al., 2005 [eu61]
MARKER RELATIONSHIPS
eu61 Is Encoded by: [Gene] fgfrl1a (1)
SEQUENCE INFORMATIONNo data available
OTHER eu61 EST PAGESNo links to external sites
CITATIONS (1)