CRISPR

CRISPR3-eipr1

ID
ZDB-CRISPR-260804-1
Name
CRISPR3-eipr1
Previous Names
None
Target
Sequence
5' - GTCAACACGGCCTTGTCTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR3-eipr1
No data available
Phenotype
Phenotype resulting from CRISPR3-eipr1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-eipr1
Phenotype Fish Conditions Figures
brain ab5-casp3 labeling increased distribution, abnormal AB/TL + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 control Fig. 7 with image from Ghosh et al., 2025
trunk Ab13-map1lc3b labeling increased distribution, abnormal AB/TL + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 control Fig. 7 with image from Ghosh et al., 2025
eye decreased area, abnormal AB/TL + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 control Fig. 7 with imageFig. 8 with image from Ghosh et al., 2025
whole organism decreased length, abnormal AB/TL + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 control Fig. 7 with imageFig. 8 with image from Ghosh et al., 2025
brain decreased area, abnormal AB/TL + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 control Fig. 7 with image from Ghosh et al., 2025
head area, abnormal AB/TL + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 control Fig. 7 with imageFig. 8 with image from Ghosh et al., 2025
brain neuronal stem cell amount, ameliorated zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) chemical treatment by environment: sirolimus Fig. 7 with image from Ghosh et al., 2025
swimming behavior decreased process quality, abnormal zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 8 with image from Ghosh et al., 2025
neuronal stem cell decreased amount, abnormal zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with image from Ghosh et al., 2025
brain neuronal stem cell GFP expression spatial pattern, ameliorated zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) chemical treatment by environment: sirolimus Fig. 7 with image from Ghosh et al., 2025
neuronal stem cell GFP expression decreased distribution, abnormal zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with image from Ghosh et al., 2025
brain neuronal stem cell GFP expression decreased distribution, abnormal zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with imageFig. 8 with image from Ghosh et al., 2025
brain neuronal stem cell decreased amount, abnormal zf168Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with imageFig. 8 with image from Ghosh et al., 2025
brain GABAergic neuron GFP expression decreased distribution, abnormal nns9Tg; ot56Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with image from Ghosh et al., 2025
brain GABAergic neuron decreased amount, abnormal nns9Tg; ot56Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with image from Ghosh et al., 2025
optic tectum glutamatergic neuron DsRed expression decreased amount, abnormal nns9Tg; ot56Tg + CRISPR1-eipr1 + CRISPR2-eipr1 + CRISPR3-eipr1 (AB/TL) control Fig. 7 with image from Ghosh et al., 2025
Citations