CRISPR

CRISPR6-men1

ID

ZDB-CRISPR-260701-3

Name

CRISPR6-men1

Previous Names

None

Target

men1 (1)

Sequence

5' - GTTTTGCAATCACTGTTTTA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf4358	men1

Expression

Gene expression in Wild Types + CRISPR6-men1

No data available

Phenotype

Phenotype resulting from CRISPR6-men1

No data available

Phenotype of all Fish created by or utilizing CRISPR6-men1

Phenotype	Fish	Conditions	Figures
intestinal epithelial cell necrotic, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-ki67 labeling increased amount, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell increased volume, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
thyroid follicle adipose tissue proliferative, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
thyroid follicle hyperplastic, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal villus decreased size, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab4-bax labeling increased amount, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab8-hsp70 labeling increased amount, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 8 from Zeng et al., 2025
intestine goblet cell proliferative, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
adipose tissue cell population proliferation increased process quality, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-BrdU labeling increased amount, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestine lymphocyte infiltrative, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestine cell increased volume, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal mucosa increased thickness, abnormal	men1^{zf4358/zf4358}	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell necrotic, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-ki67 labeling increased amount, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
thyroid follicle hyperplastic, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell increased volume, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
thyroid follicle adipose tissue proliferative, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal villus decreased size, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab8-hsp70 labeling increased amount, abnormal	men1^zf4358/+	standard conditions	Fig. 8 from Zeng et al., 2025
intestinal epithelial cell Ab4-bax labeling increased amount, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestine goblet cell proliferative, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
adipose tissue cell population proliferation increased process quality, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-BrdU labeling increased amount, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestine lymphocyte infiltrative, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestinal mucosa increased thickness, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025
intestine cell increased volume, abnormal	men1^zf4358/+	standard conditions	Fig. 7 from Zeng et al., 2025

Citations