CRISPR

CRISPR4-men1

ID
ZDB-CRISPR-260701-1
Name
CRISPR4-men1
Previous Names
None
Target
Sequence
5' - GGTACCTGTAATCAGACTGAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4358 men1
Expression
Gene expression in Wild Types + CRISPR4-men1
No data available
Phenotype
Phenotype resulting from CRISPR4-men1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-men1
Phenotype Fish Conditions Figures
intestinal epithelial cell necrotic, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-ki67 labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell increased volume, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle adipose tissue proliferative, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle hyperplastic, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal villus decreased size, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab4-bax labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab8-hsp70 labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 8 from Zeng et al., 2025
intestine goblet cell proliferative, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
adipose tissue cell population proliferation increased process quality, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-BrdU labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestine lymphocyte infiltrative, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestine cell increased volume, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal mucosa increased thickness, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell necrotic, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-ki67 labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle hyperplastic, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell increased volume, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle adipose tissue proliferative, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal villus decreased size, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab8-hsp70 labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 8 from Zeng et al., 2025
intestinal epithelial cell Ab4-bax labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestine goblet cell proliferative, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
adipose tissue cell population proliferation increased process quality, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-BrdU labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestine lymphocyte infiltrative, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal mucosa increased thickness, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestine cell increased volume, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
Citations