CRISPR

CRISPR3-men1

ID
ZDB-CRISPR-260630-2
Name
CRISPR3-men1
Previous Names
None
Target
Sequence
5' - GGACTCCATCAATGCCTCGAAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"S were added. There is a single base pair difference between this CRISPR and the sequence in GRC12tu "ggACTCCATC(G>A)ATGCCTCGAAG".
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4358 men1
Expression
Gene expression in Wild Types + CRISPR3-men1
No data available
Phenotype
Phenotype resulting from CRISPR3-men1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-men1
Phenotype Fish Conditions Figures
intestinal epithelial cell necrotic, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-ki67 labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell increased volume, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle adipose tissue proliferative, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle hyperplastic, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal villus decreased size, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab4-bax labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab8-hsp70 labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 8 from Zeng et al., 2025
intestine goblet cell proliferative, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
adipose tissue cell population proliferation increased process quality, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-BrdU labeling increased amount, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestine lymphocyte infiltrative, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestine cell increased volume, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal mucosa increased thickness, abnormal men1zf4358/zf4358 standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell necrotic, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-ki67 labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle hyperplastic, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell increased volume, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
thyroid follicle adipose tissue proliferative, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal villus decreased size, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab8-hsp70 labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 8 from Zeng et al., 2025
intestinal epithelial cell Ab4-bax labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestine goblet cell proliferative, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
adipose tissue cell population proliferation increased process quality, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal epithelial cell Ab10-BrdU labeling increased amount, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestine lymphocyte infiltrative, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestinal mucosa increased thickness, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
intestine cell increased volume, abnormal men1zf4358/+ standard conditions Fig. 7 from Zeng et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.