CRISPR

CRISPR2-and1

ID
ZDB-CRISPR-260429-2
Name
CRISPR2-and1
Previous Names
None
Target
Sequence
5' - AGCACTCTGACTTCTGGAATTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ot1016 and1
Expression
Gene expression in Wild Types + CRISPR2-and1
No data available
Phenotype
Phenotype resulting from CRISPR2-and1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-and1
Phenotype Fish Conditions Figures
fin fold pectoral fin bud and1 expression absent, abnormal and1ot1016/ot1016 standard conditions Fig. 1. with image from Hanzelova et al., 2026
median fin fold and1 expression absent, abnormal and1ot1016/ot1016 standard conditions Fig. 1. with image from Hanzelova et al., 2026
pelvic fin decreased width, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
pectoral fin decreased length, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
caudal fin decreased length, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
anal fin decreased width, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
pectoral fin actinotrichium absence of anatomical entity, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
parhypural fused with hypural 1, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 5. with image from Hanzelova et al., 2026
dorsal fin lepidotrichium decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
caudal fin ab1-col2a labeling spatial pattern, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image,  Fig. 5. with image from Hanzelova et al., 2026
anal fin lepidotrichium decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
fin fold pectoral fin bud and1 expression absent, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
median fin fold Ab3-and1 labeling absent, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
dorsal fin decreased length, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
post-vent region melanocyte disorganized, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 5. with image from Hanzelova et al., 2026
breeding tubercle spatial pattern, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 6. with image from Hanzelova et al., 2026
caudal fin decreased width, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
pelvic fin decreased length, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
breeding tubercle organization quality, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 6. with image from Hanzelova et al., 2026
fin fold pectoral fin bud and2 expression absent, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
caudal fin lepidotrichium decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
caudal fin principal ray joint irregular spatial pattern, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
pelvic fin lepidotrichium decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
median fin fold anatomical margin irregularly shaped, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
caudal fin principal ray increased width, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
median fin fold ab1-col2a labeling spatial pattern, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
post-vent region and4 expression increased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
male organism male courtship behavior decreased process quality, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 6. with image from Hanzelova et al., 2026
branched caudal fin ray blunt, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
post-vent region and1 expression decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
branched dorsal fin ray decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
median fin fold and1 expression absent, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
caudal fin actinotrichium absence of anatomical entity, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image,  Fig. 5. with image from Hanzelova et al., 2026
branched caudal fin ray decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
pectoral fin fold anatomical margin irregularly shaped, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
branched anal fin ray decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
caudal fin principal ray deformed, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
dorsal fin decreased width, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
pectoral fin decreased width, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
median fin fold wrinkled, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
breeding tubercle decreased size, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 6. with image from Hanzelova et al., 2026
post-vent region and2 expression decreased amount, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
caudal fin principal ray undulate, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
anal fin decreased length, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 3. with image from Hanzelova et al., 2026
pectoral fin fold wrinkled, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 2. with image from Hanzelova et al., 2026
branched caudal fin ray broken, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
caudal fin Ab3-and1 labeling absent, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 4. with image from Hanzelova et al., 2026
median fin fold and2 expression absent, abnormal and1ot1016/ot1016; and2ot1017/ot1017 standard conditions Fig. 1. with image from Hanzelova et al., 2026
mesenchyme median fin fold EGFP expression spatial pattern, abnormal and1ot1016/ot1016; and2ot1017/ot1017; sqet37Et standard conditions Fig. 2. with image from Hanzelova et al., 2026
pectoral fin fold mesenchyme EGFP expression spatial pattern, abnormal and1ot1016/ot1016; and2ot1017/ot1017; sqet37Et standard conditions Fig. 2. with image from Hanzelova et al., 2026
mesenchyme median fin fold mesenchymal cell disorganized, abnormal and1ot1016/ot1016; and2ot1017/ot1017; sqet37Et standard conditions Fig. 2. with image from Hanzelova et al., 2026
pectoral fin fold mesenchymal cell disorganized, abnormal and1ot1016/ot1016; and2ot1017/ot1017; sqet37Et standard conditions Fig. 2. with image from Hanzelova et al., 2026
Citations