CRISPR

CRISPR1-and1

ID

ZDB-CRISPR-260429-1

Name

CRISPR1-and1

Previous Names

None

Target

and1 (1)

Sequence

5' - TTGGTGTGAACCTCTAAAGAGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ot1016	and1

Expression

Gene expression in Wild Types + CRISPR1-and1

No data available

Phenotype

Phenotype resulting from CRISPR1-and1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-and1

Phenotype	Fish	Conditions	Figures
fin fold pectoral fin bud and1 expression absent, abnormal	and1^{ot1016/ot1016}	standard conditions	Fig. 1. from Hanzelova et al., 2026
median fin fold and1 expression absent, abnormal	and1^{ot1016/ot1016}	standard conditions	Fig. 1. from Hanzelova et al., 2026
pelvic fin decreased width, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
pectoral fin decreased length, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
caudal fin decreased length, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
anal fin decreased width, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
pectoral fin actinotrichium absence of anatomical entity, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
parhypural fused with hypural 1, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 5. from Hanzelova et al., 2026
dorsal fin lepidotrichium decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
caudal fin ab1-col2a labeling spatial pattern, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. , Fig. 5. from Hanzelova et al., 2026
anal fin lepidotrichium decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
fin fold pectoral fin bud and1 expression absent, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
median fin fold Ab3-and1 labeling absent, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
dorsal fin decreased length, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
post-vent region melanocyte disorganized, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 5. from Hanzelova et al., 2026
breeding tubercle spatial pattern, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 6. from Hanzelova et al., 2026
caudal fin decreased width, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
pelvic fin decreased length, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
breeding tubercle organization quality, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 6. from Hanzelova et al., 2026
fin fold pectoral fin bud and2 expression absent, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
caudal fin lepidotrichium decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
caudal fin principal ray joint irregular spatial pattern, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
pelvic fin lepidotrichium decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
median fin fold anatomical margin irregularly shaped, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
caudal fin principal ray increased width, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
median fin fold ab1-col2a labeling spatial pattern, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
post-vent region and4 expression increased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
male organism male courtship behavior decreased process quality, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 6. from Hanzelova et al., 2026
branched caudal fin ray blunt, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
post-vent region and1 expression decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
branched dorsal fin ray decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
median fin fold and1 expression absent, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
caudal fin actinotrichium absence of anatomical entity, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. , Fig. 5. from Hanzelova et al., 2026
branched caudal fin ray decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
pectoral fin fold anatomical margin irregularly shaped, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
branched anal fin ray decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
caudal fin principal ray deformed, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
dorsal fin decreased width, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
pectoral fin decreased width, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
median fin fold wrinkled, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
breeding tubercle decreased size, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 6. from Hanzelova et al., 2026
post-vent region and2 expression decreased amount, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
caudal fin principal ray undulate, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
anal fin decreased length, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 3. from Hanzelova et al., 2026
pectoral fin fold wrinkled, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 2. from Hanzelova et al., 2026
branched caudal fin ray broken, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
caudal fin Ab3-and1 labeling absent, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 4. from Hanzelova et al., 2026
median fin fold and2 expression absent, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}	standard conditions	Fig. 1. from Hanzelova et al., 2026
mesenchyme median fin fold EGFP expression spatial pattern, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}; sqet37Et	standard conditions	Fig. 2. from Hanzelova et al., 2026
pectoral fin fold mesenchyme EGFP expression spatial pattern, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}; sqet37Et	standard conditions	Fig. 2. from Hanzelova et al., 2026
mesenchyme median fin fold mesenchymal cell disorganized, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}; sqet37Et	standard conditions	Fig. 2. from Hanzelova et al., 2026
pectoral fin fold mesenchymal cell disorganized, abnormal	and1^{ot1016/ot1016}; and2^{ot1017/ot1017}; sqet37Et	standard conditions	Fig. 2. from Hanzelova et al., 2026

Citations