CRISPR

CRISPR1-gtf3aa

ID
ZDB-CRISPR-260421-10
Name
CRISPR1-gtf3aa
Previous Names
None
Target
Sequence
5' - ACGCGTATTACAACCGAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ihb950 gtf3aa
Expression
Gene expression in Wild Types + CRISPR1-gtf3aa
No data available
Phenotype
Phenotype resulting from CRISPR1-gtf3aa
No data available
Phenotype of all Fish created by or utilizing CRISPR1-gtf3aa
Phenotype Fish Conditions Figures
liver gc expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 10 with image from Luo et al., 2025
whole organism large ribosomal subunit decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 5 with image from Luo et al., 2025
whole organism fads2 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
whole organism rpl35 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 5 with image from Luo et al., 2025
whole organism cpt1b expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
heart increased size, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 6 with imageFig. 7 with image from Luo et al., 2025
whole organism dead, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 4 with image from Luo et al., 2025
whole organism fabp6 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
whole organism decreased length, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 6 with imageFig. 7 with image from Luo et al., 2025
whole organism scp2a expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
whole organism ribosome increased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 5 with image from Luo et al., 2025
liver uox expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 10 with image from Luo et al., 2025
whole organism pdpk1a expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
liver fabp10a expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 8 with imageFig. 10 with image from Luo et al., 2025
whole organism hmgcs1 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
whole organism cpt2 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
whole organism viability, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 4 with image from Luo et al., 2025
yolk syncytial layer increased size, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 6 with imageFig. 7 with image from Luo et al., 2025
intestine fabp2 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 8 with image from Luo et al., 2025
eye decreased size, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 6 with imageFig. 7 with image from Luo et al., 2025
whole organism acadl expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
whole organism cd36 expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 9 with image from Luo et al., 2025
liver tfa expression decreased amount, abnormal gtf3aaihb950/ihb950 (AB) standard conditions Fig. 8 with imageFig. 10 with image from Luo et al., 2025
Citations