CRISPR

CRISPR2-nr6a1a

ID
ZDB-CRISPR-260414-1
Name
CRISPR2-nr6a1a
Previous Names
None
Target
Sequence
5' - AATGCCATAGTGCAGTCCTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ulg083 nr6a1a
Expression
Gene expression in Wild Types + CRISPR2-nr6a1a
No data available
Phenotype
Phenotype resulting from CRISPR2-nr6a1a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-nr6a1a
Phenotype Fish Conditions Figures
kidney decreased area, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 2 with image from Jacquinet et al., 2026
spinal cord hoxa9b expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 4 with image from Jacquinet et al., 2026
whole organism decreased length, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 2 with image from Jacquinet et al., 2026
pronephros clcnk expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 3 with image from Jacquinet et al., 2026
pronephric duct opening shape, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 3 with image from Jacquinet et al., 2026
neural tube posterior region hoxa13b expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 4 with image from Jacquinet et al., 2026
neural tube posterior region hoxd11a expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 4 with image from Jacquinet et al., 2026
neural tube posterior region hoxb13a expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 4 with image from Jacquinet et al., 2026
trunk anterior side decreased length, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 2 with image from Jacquinet et al., 2026
precaudal vertebra decreased amount, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 2 with image from Jacquinet et al., 2026
kidney morphology, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 2 with image from Jacquinet et al., 2026
neural tube posterior region hoxa11b expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 4 with image from Jacquinet et al., 2026
cloaca morphology, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 3 with image from Jacquinet et al., 2026
pronephros gata3 expression increased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 3 with image from Jacquinet et al., 2026
pronephros trpm7 expression decreased distribution, abnormal nr6a1aulg083/ulg083 standard conditions Fig. 3 with image from Jacquinet et al., 2026
pronephric duct opening shape, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/+ standard conditions Fig. 3 with image from Jacquinet et al., 2026
cloaca morphology, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/+ standard conditions Fig. 3 with image from Jacquinet et al., 2026
neural tube posterior region hoxb13a expression increased distribution, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/+ standard conditions Fig. 4 with image from Jacquinet et al., 2026
spinal cord hoxa9b expression increased distribution, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/+ standard conditions Fig. 4 with image from Jacquinet et al., 2026
spinal cord hoxa9b expression increased distribution, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/ulg085 standard conditions Fig. 4 with image from Jacquinet et al., 2026
pronephric duct opening shape, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/ulg085 standard conditions Fig. 3 with image from Jacquinet et al., 2026
neural tube posterior region hoxb13a expression increased distribution, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/ulg085 standard conditions Fig. 4 with image from Jacquinet et al., 2026
cloaca morphology, abnormal nr6a1aulg083/ulg083; nr6a1bulg085/ulg085 standard conditions Fig. 3 with image from Jacquinet et al., 2026
Citations