CRISPR

CRISPR1-gpr171

ID

ZDB-CRISPR-260310-1

Name

CRISPR1-gpr171

Previous Names

None

Target

gpr171 (1)

Sequence

5' - GATTGGGATGGTGACTAGCTTGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zju801	gpr171

Expression

Gene expression in Wild Types + CRISPR1-gpr171

No data available

Phenotype

Phenotype resulting from CRISPR1-gpr171

No data available

Phenotype of all Fish created by or utilizing CRISPR1-gpr171

Phenotype	Fish	Conditions	Figures
caudal hematopoietic tissue myb expression decreased distribution, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 1 from Zhou et al., 2026
whole organism notch3 expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 4 from Zhou et al., 2026
whole organism notch1a expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta myb expression decreased distribution, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 1 from Zhou et al., 2026
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased distribution, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 3 from Zhou et al., 2026
whole organism dla expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 4 from Zhou et al., 2026
caudal hematopoietic tissue myb expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 1 from Zhou et al., 2026
whole organism Ab35-mapk labeling decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 3 from Zhou et al., 2026
whole organism dlb expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 4 from Zhou et al., 2026
whole organism jag1a expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell myb expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 3 from Zhou et al., 2026
ventral wall of dorsal aorta myb expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 1 from Zhou et al., 2026
whole organism her15.1 expression decreased amount, abnormal	gpr171^{zju801/zju801}	standard conditions	Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased amount, abnormal	gpr171^{zju801/zju801}; ioz1Tg/ioz1Tg; s896Tg/s896Tg	standard conditions	Fig. 1 , Fig. 2 , Fig. 3 , Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell EGFP expression decreased distribution, abnormal	gpr171^{zju801/zju801}; ioz1Tg/ioz1Tg; s896Tg/s896Tg	standard conditions	Fig. 1 , Fig. 2 , Fig. 3 from Zhou et al., 2026
dorsal aorta EGFP expression decreased amount, abnormal	gpr171^{zju801/zju801}; um14Tg/um14Tg	standard conditions	Fig. 4 , Fig. 5 from Zhou et al., 2026
dorsal aorta EGFP expression decreased amount, abnormal	gpr171^{zju801/zju801}; um14Tg/um14Tg	chemical treatment by environment: SCH772984	Fig. 5 from Zhou et al., 2026
ventral wall of dorsal aorta myb expression decreased amount, abnormal	gpr171^{zju801/zju801}; kca3Tg/kca3Tg; kca4Tg/kca4Tg	standard conditions	Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta myb expression spatial pattern, ameliorated	gpr171^{zju801/zju801}; kca3Tg/kca3Tg; kca4Tg/kca4Tg	heat shock	Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta myb expression amount, ameliorated	gpr171^{zju801/zju801}; kca3Tg/kca3Tg; kca4Tg/kca4Tg	heat shock	Fig. 4 from Zhou et al., 2026
ventral wall of dorsal aorta myb expression decreased distribution, abnormal	gpr171^{zju801/zju801}; kca3Tg/kca3Tg; kca4Tg/kca4Tg	standard conditions	Fig. 4 from Zhou et al., 2026

Citations