CRISPR

CRISPR2-mir499a

ID
ZDB-CRISPR-260309-3
Name
CRISPR2-mir499a
Previous Names
None
Target
Sequence
5' - GGCTGCCTCCCTCTCAGTAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sou23 mir499a
Expression
Gene expression in Wild Types + CRISPR2-mir499a
No data available
Phenotype
Phenotype resulting from CRISPR2-mir499a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-mir499a
Phenotype Fish Conditions Figures
intermuscular bone ossification decreased process quality, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
skeletal muscle tnnc2.2 expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
slow muscle cell decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 3 with image from Che et al., 2025
epineural decreased length, abnormal mir499asou23/sou23 (AB) standard conditions Figure 6 with image from Che et al., 2025
skeletal muscle smyhc2 expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
epineural decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 6 with image from Che et al., 2025
epipleural decreased length, abnormal mir499asou23/sou23 (AB) standard conditions Figure 6 with image from Che et al., 2025
intermuscular bone bmp6 expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
intermuscular bone runx2b expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
intermuscular bone bmp2b expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
skeletal muscle mylpfb expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
skeletal muscle mylpfa expression increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
epipleural ossification decreased rate of continuous process, abnormal mir499asou23/sou23 (AB) standard conditions Figure 6 with image from Che et al., 2025
skeletal muscle smyhc1 expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
epipleural decreased area, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
skeletal muscle myhz1.1l expression increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with imageFigure 6 with image from Che et al., 2025
skeletal muscle myhz2 expression increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with imageFigure 6 with image from Che et al., 2025
fast muscle cell increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 3 with image from Che et al., 2025
whole organism mir499a expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 1 with image from Che et al., 2025
swimming behavior decreased process quality, abnormal mir499asou23/sou23 (AB) standard conditions Figure 4 with imageFigure 6 with image from Che et al., 2025
skeletal muscle myha expression increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
intermuscular bone sp7 expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
epineural ossification decreased rate of continuous process, abnormal mir499asou23/sou23 (AB) standard conditions Figure 6 with image from Che et al., 2025
epineural decreased area, abnormal mir499asou23/sou23 (AB) standard conditions Figure 5 with image from Che et al., 2025
skeletal muscle myh7ba expression decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with image from Che et al., 2025
slow muscle cell ab-f59 labeling decreased distribution, abnormal mir499asou23/sou23 (AB) standard conditions Figure 3 with image from Che et al., 2025
epipleural decreased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 6 with image from Che et al., 2025
skeletal muscle myhb expression increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with imageFigure 6 with image from Che et al., 2025
skeletal muscle sox6 expression increased amount, abnormal mir499asou23/sou23 (AB) standard conditions Figure 2 with imageFigure 6 with image from Che et al., 2025
Citations