CRISPR

CRISPR2-pex1

ID
ZDB-CRISPR-251218-3
Name
CRISPR2-pex1
Previous Names
None
Target
Sequence
5' - AGATGGCTGACAGACCTAGG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
lux4 pex1
Expression
Gene expression in Wild Types + CRISPR2-pex1
No data available
Phenotype
Phenotype resulting from CRISPR2-pex1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-pex1
Phenotype Fish Conditions Figures
brain very long-chain fatty acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
swimming behavior decreased process quality, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 6 with image from Heins-Marroquin et al., 2025
whole organism isg15 expression increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 5 with image from Heins-Marroquin et al., 2025
retinal outer nuclear layer decreased thickness, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 7 with image from Heins-Marroquin et al., 2025
hepatocyte peroxisomal matrix Ab5-cat labeling decreased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
hepatocyte peroxisomal membrane Ab3-abcd3 labeling decreased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
whole organism hpxa expression decreased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 5 with image from Heins-Marroquin et al., 2025
liver increased size, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 2 with image from Heins-Marroquin et al., 2025
liver vacuole increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 2 with image from Heins-Marroquin et al., 2025
retinal cone cell Ab2-arr3a labeling spatial pattern, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 6 with image from Heins-Marroquin et al., 2025
brain ultra-long-chain fatty acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
whole organism phosphatidylcholine increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 4 with image from Heins-Marroquin et al., 2025
whole organism viability, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 2 with image from Heins-Marroquin et al., 2025
whole organism scd expression increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 5 with image from Heins-Marroquin et al., 2025
ovary degenerate, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 2 with image from Heins-Marroquin et al., 2025
whole organism triglyceride increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 4 with image from Heins-Marroquin et al., 2025
liver pex1 expression absent, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 1 with image from Heins-Marroquin et al., 2025
whole organism dihydroceramide increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 4 with image from Heins-Marroquin et al., 2025
retinal cone cell cone photoreceptor outer segment disorganized, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 7 with image from Heins-Marroquin et al., 2025
liver very long-chain fatty acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
whole organism phytanic acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 4 with image from Heins-Marroquin et al., 2025
brain phytanic acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
whole organism rida expression decreased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 5 with image from Heins-Marroquin et al., 2025
liver phytanic acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
liver ultra-long-chain fatty acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 3 with image from Heins-Marroquin et al., 2025
whole organism hspa5 expression increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 5 with image from Heins-Marroquin et al., 2025
liver lipid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 2 with image,  FIGURE 4 with image from Heins-Marroquin et al., 2025
whole organism arf4b expression increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 5 with image from Heins-Marroquin et al., 2025
whole organism pristanic acid increased amount, abnormal pex1lux4/lux4 (AB) standard conditions FIGURE 4 with image from Heins-Marroquin et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.