CRISPR

CRISPR3-sgms2a

ID
ZDB-CRISPR-251201-4
Name
CRISPR3-sgms2a
Previous Names
None
Target
Sequence
5' - TCTGGCGGTGGATTATCAATCAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR3-sgms2a
No data available
Phenotype
Phenotype resulting from CRISPR3-sgms2a
No data available
Phenotype of all Fish created by or utilizing CRISPR3-sgms2a
Phenotype Fish Conditions Figures
head decreased length, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
palatoquadrate cartilage increased angle to Meckel's cartilage, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
notochord biomineral tissue development decreased process quality, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 5 with image from Määttä et al., 2025
Meckel's cartilage increased angle to Meckel's cartilage, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
eye decreased distance eye, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
eye increased width, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
whole organism decreased life span, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 4 with image from Määttä et al., 2025
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
palatoquadrate cartilage increased angle to ceratohyal cartilage, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
eye size, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
whole organism deformed, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 4 with image from Määttä et al., 2025
notochord bent, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 5 with image from Määttä et al., 2025
notochord deformed, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 5 with image from Määttä et al., 2025
eye morphology, abnormal AB + CRISPR2-sgms2a + CRISPR3-sgms2a + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
head decreased length, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
palatoquadrate cartilage increased angle to Meckel's cartilage, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
notochord biomineral tissue development decreased process quality, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 5 with image from Määttä et al., 2025
Meckel's cartilage increased angle to Meckel's cartilage, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
whole organism decreased life span, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 4 with image from Määttä et al., 2025
palatoquadrate cartilage increased angle to ceratohyal cartilage, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
notochord bent, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 5 with image from Määttä et al., 2025
whole organism deformed, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 4 with image from Määttä et al., 2025
eye size, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
eye morphology, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 6 with image from Määttä et al., 2025
notochord deformed, abnormal AB + CRISPR1-sgms2b + CRISPR2-sgms2a + CRISPR2-sgms2b + CRISPR3-sgms2a + CRISPR3-sgms2b + CRISPR4-sgms2a standard conditions Figure 5 with image from Määttä et al., 2025
Citations