CRISPR

CRISPR1-tssk6

ID
ZDB-CRISPR-251028-1
Name
CRISPR1-tssk6
Previous Names
None
Target
Sequence
5' - GGCGTTCCTGTGATGACCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4327 tssk6
Expression
Gene expression in Wild Types + CRISPR1-tssk6
No data available
Phenotype
Phenotype resulting from CRISPR1-tssk6
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tssk6
Phenotype Fish Conditions Figures
testis spermatocyte decreased area, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
male organism testis sox4a expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis cyp17a1 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
testis sperm decreased area, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
male organism testis actn1 expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis cpeb4a expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis stard10 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis pde6d expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis dab2 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis pimr153 expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis prkar1b expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis zar1l expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis ect2 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis dnal4b expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis Ab1-tssk6 labeling decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 3 from Ma et al., 2025
male organism testis gpsm2 expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
sperm sperm motility decreased process quality, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 5 from Ma et al., 2025
male organism testis pias2 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis cldn11b expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis zbtb16a expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
male organism testis decreased size, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 3 from Ma et al., 2025
male organism testis ar expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
male organism decreased weight, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 3 from Ma et al., 2025
male organism testis waplb expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis scn1ba expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism decreased length, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 3 from Ma et al., 2025
male organism testis ccnb3 expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis tpx2 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis igf2bp3 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis dmrt1 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
male organism testis iqub expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
testis sperm area density, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 5 from Ma et al., 2025
male organism testis scn1laa expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis map1ab expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
testis spermatogonium decreased area, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 4 from Ma et al., 2025
male organism testis foxj1b expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
male organism testis zp3 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis apoda.2 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis nav2a expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis nanog expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism testis ppp1r10 expression increased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 1 from Ma et al., 2025
male organism spermatogenesis decreased process quality, abnormal tssk6zf4327/zf4327 (AB) standard conditions Fig. 5 from Ma et al., 2025
male organism testis psip1b expression decreased amount, abnormal tssk6zf4327/zf4327 (AB) standard conditions Table 2 from Ma et al., 2025
whole organism viability, abnormal tssk6zf4327/+ (AB) standard conditions Fig. 4 from Ma et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.