CRISPR

CRISPR4-ndufs2

ID
ZDB-CRISPR-251006-1
Name
CRISPR4-ndufs2
Previous Names
None
Target
Sequence
5' - GTTCTTCCAGATACGATTAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cri4 ndufs2
Expression
Gene expression in Wild Types + CRISPR4-ndufs2
No data available
Phenotype
Phenotype resulting from CRISPR4-ndufs2
No data available
Phenotype of all Fish created by or utilizing CRISPR4-ndufs2
No data available
Citations