CRISPR

CRISPR2-ankrd1a

ID
ZDB-CRISPR-250915-1
Name
CRISPR2-ankrd1a
Previous Names
None
Target
Sequence
5' - GGAGAAATATTTAGTGGATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
bns502 ankrd1a
Expression
Gene expression in Wild Types + CRISPR2-ankrd1a
No data available
Phenotype
Phenotype resulting from CRISPR2-ankrd1a
No data available
Phenotype of all Fish created by or utilizing CRISPR2-ankrd1a
No data available
Citations