CRISPR

CRISPR1-tedc1

ID
ZDB-CRISPR-250904-9
Name
CRISPR1-tedc1
Previous Names
None
Target
Sequence
5' - GGCACTGGACTGTGCGTGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4253 tedc1
Expression
Gene expression in Wild Types + CRISPR1-tedc1
No data available
Phenotype
Phenotype resulting from CRISPR1-tedc1
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tedc1
Phenotype Fish Conditions Figures
proximal straight tubule epithelial cell disorganized, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
proximal convoluted tubule epithelial cell disorganized, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
sperm decreased amount, abnormal tedc1zf4253/zf4253 standard conditions Fig. S10 from Miyake et al., 2025
spermatogenic cyst absence of anatomical entity, abnormal tedc1zf4253/zf4253 standard conditions Fig. S10 from Miyake et al., 2025
vertebral column curvature, abnormal tedc1zf4253/zf4253 standard conditions Fig. 3 from Miyake et al., 2025
trunk curvature, abnormal tedc1zf4253/zf4253 standard conditions Fig. 3 from Miyake et al., 2025
whole organism decreased length, abnormal tedc1zf4253/zf4253 standard conditions Fig. 3 from Miyake et al., 2025
renal tubule nucleate erythrocyte decreased amount, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
distal early tubule increased size, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
testis decreased size, abnormal tedc1zf4253/zf4253 standard conditions Fig. S9,  Fig. S10 from Miyake et al., 2025
cranium dysplastic, abnormal tedc1zf4253/zf4253 standard conditions Fig. 3 from Miyake et al., 2025
renal tubule vacuole absence of anatomical entity, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
muscle cell cilium ab1-tuba labeling spatial pattern, abnormal tedc1zf4253/zf4253 standard conditions Fig. 4 from Miyake et al., 2025
proximal convoluted tubule brush border epithelial cell disorganized, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
distal late tubule increased size, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
muscle cell cilium disorganized, abnormal tedc1zf4253/zf4253 standard conditions Fig. 4 from Miyake et al., 2025
proximal straight tubule brush border epithelial cell disorganized, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
distal early tubule decreased amount, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
muscle cell cilium structurally discontinuous, abnormal tedc1zf4253/zf4253 standard conditions Fig. 4 from Miyake et al., 2025
distal late tubule decreased amount, abnormal tedc1zf4253/zf4253 standard conditions Fig. S8 from Miyake et al., 2025
Citations