CRISPR

CRISPR1-akr7a3

ID
ZDB-CRISPR-250815-3
Name
CRISPR1-akr7a3
Previous Names
None
Target
Sequence
5' - GGACAAGCGGAGAGCATCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4355 akr7a3
Expression
Gene expression in Wild Types + CRISPR1-akr7a3
No data available
Phenotype
Phenotype resulting from CRISPR1-akr7a3
No data available
Phenotype of all Fish created by or utilizing CRISPR1-akr7a3
Phenotype Fish Conditions Figures
whole organism ptgs2a expression decreased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye tnfa expression increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 7 with image from Zhang et al., 2025
kidney nphs1 expression decreased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 4 with image from Zhang et al., 2025
liver acrolein increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 1 with image from Zhang et al., 2025
kidney nphs2 expression decreased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 4 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression spatial pattern, ameliorated akr7a3zf4355/zf4355 chemical treatment by environment: leukotriene antagonist Fig. 7 with image from Zhang et al., 2025
linoleic acid metabolic process increased occurrence, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye steroid biosynthetic process increased occurrence, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye il1b expression increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 7 with image from Zhang et al., 2025
eye ltb4r expression increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 7 with image from Zhang et al., 2025
eye arachidonate metabolic process increased occurrence, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression spatial pattern, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 6 with image,  Fig. 7 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression amount, ameliorated akr7a3zf4355/zf4355 chemical treatment by environment: leukotriene antagonist Fig. 7 with image from Zhang et al., 2025
eye ptgs2a expression decreased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
whole organism lta4h expression increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
whole organism acrolein increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 1 with image from Zhang et al., 2025
steroid biosynthetic process increased occurrence, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression amount, ameliorated akr7a3zf4355/zf4355 chemical treatment by environment: leukotriene A4 Fig. 6 with image from Zhang et al., 2025
retina vasculature increased diameter, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 3 with image from Zhang et al., 2025
kidney acrolein increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 1 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression increased distribution, abnormal akr7a3zf4355/zf4355 chemical treatment by environment: quininib Fig. 7 with image from Zhang et al., 2025
sphingolipid metabolic process increased occurrence, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye lta4h expression increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression increased distribution, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 6 with image,  Fig. 7 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression spatial pattern, ameliorated akr7a3zf4355/zf4355 chemical treatment by environment: leukotriene A4 Fig. 6 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression spatial pattern, abnormal akr7a3zf4355/zf4355 chemical treatment by environment: quininib Fig. 7 with image from Zhang et al., 2025
arachidonate metabolic process increased occurrence, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 5 with image from Zhang et al., 2025
glomerular basement membrane increased thickness, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 3 with image from Zhang et al., 2025
eye acrolein increased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 1 with image from Zhang et al., 2025
whole organism glutathione decreased amount, abnormal akr7a3zf4355/zf4355 standard conditions Fig. 1 with image from Zhang et al., 2025
eye hyaloid vessel increased diameter, abnormal akr7a3zf4355/zf4355; y1Tg/y1Tg standard conditions Fig. 2 with image from Zhang et al., 2025
eye hyaloid vessel EGFP expression increased distribution, abnormal akr7a3zf4355/zf4355; y1Tg/y1Tg standard conditions Fig. 2 with image from Zhang et al., 2025
Citations