CRISPR

CRISPR3-atad3

ID

ZDB-CRISPR-250724-2

Name

CRISPR3-atad3

Previous Names

None

Target

atad3 (1)

Sequence

5' - ACGGTTCAGATGGAGCACCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf4266	atad3

Expression

Gene expression in Wild Types + CRISPR3-atad3

No data available

Phenotype

Phenotype resulting from CRISPR3-atad3

No data available

Phenotype of all Fish created by or utilizing CRISPR3-atad3

Phenotype	Fish	Conditions	Figures
whole organism dead, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
head mitochondrial respiratory chain complex III assembly decreased process quality, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 2 from Ezer et al., 2025
head cytochrome-c oxidase activity decreased process quality, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 2 from Ezer et al., 2025
whole organism acot19 expression decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
swimming behavior decreased process quality, abnormal	atad3^{zf4266/zf4266} (AB/TL)	vibration	Fig. 3 from Ezer et al., 2025
eye decreased size, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
whole organism fabp10a expression decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
head decreased size, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
whole organism acsl5 expression decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
whole organism kars1 expression increased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
whole organism atp5fa1 expression decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
whole organism yars1 expression increased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
head ATP decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 2 from Ezer et al., 2025
head mitochondrial respiratory chain complex II assembly decreased process quality, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 2 from Ezer et al., 2025
pericardium edematous, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
whole organism iars1 expression increased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
whole organism mitochondrial chromosome decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 2 from Ezer et al., 2025
whole organism viability, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
whole organism cox8b expression decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 5 from Ezer et al., 2025
post-vent region decreased thickness, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
hatching delayed, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 from Ezer et al., 2025
whole organism atad3 expression decreased amount, abnormal	atad3^{zf4266/zf4266} (AB/TL)	standard conditions	Fig. 1 , Fig. 5 from Ezer et al., 2025
swimming behavior decreased process quality, abnormal	atad3^{zf4266/zf4266} (AB/TL)	altered light dark cycle	Fig. 3 from Ezer et al., 2025

Citations