CRISPR
CRISPR3-si:ch211-113e8.9
- ID
- ZDB-CRISPR-250603-827
- Name
- CRISPR3-si:ch211-113e8.9
- Previous Names
- None
- Target
- Sequence
-
5' - CAAGCATAAGCAATCTGTAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
| Genomic Feature | Affected Genomic Regions |
|---|---|
| zko751a | si:ch211-113e8.9 |
| zko751b | si:ch211-113e8.9 |
Expression
Gene expression in Wild Types + CRISPR3-si:ch211-113e8.9
No data available
Phenotype
Phenotype resulting from CRISPR3-si:ch211-113e8.9
No data available
Phenotype of all Fish created by or utilizing CRISPR3-si:ch211-113e8.9
No data available
Citations