CRISPR
CRISPR9-si:ch211-113e8.11
- ID
- ZDB-CRISPR-250603-1208
- Name
- CRISPR9-si:ch211-113e8.11
- Previous Names
- None
- Target
- Sequence
-
5' - TGTCTCCTCGTCTTCTGACT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
| Genomic Feature | Affected Genomic Regions |
|---|---|
| zko747a | si:ch211-113e8.11 |
Expression
Gene expression in Wild Types + CRISPR9-si:ch211-113e8.11
No data available
Phenotype
Phenotype resulting from CRISPR9-si:ch211-113e8.11
No data available
Phenotype of all Fish created by or utilizing CRISPR9-si:ch211-113e8.11
No data available
Citations