CRISPR

CRISPR1-rsad2

ID
ZDB-CRISPR-250320-5
Name
CRISPR1-rsad2
Previous Names
None
Target
Sequence
5' - GGGCGGCTGATCTTTCTAGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4050 rsad2
Expression
Gene expression in Wild Types + CRISPR1-rsad2
No data available
Phenotype
Phenotype resulting from CRISPR1-rsad2
No data available
Phenotype of all Fish created by or utilizing CRISPR1-rsad2
Phenotype Fish Conditions Figures
whole organism sod1 expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 2 with image from Shanaka et al., 2023
whole organism acaca expression increased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 2 with image from Shanaka et al., 2023
whole organism csf1a expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 3 with image from Shanaka et al., 2023
viral process increased process quality, exacerbated rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 1 with image from Shanaka et al., 2023
whole organism mpx expression increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 6 from Shanaka et al., 2022
whole organism ifnphi1 expression increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 6 from Shanaka et al., 2022
whole organism mpx expression increased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 3 with image from Shanaka et al., 2023
whole organism hif1aa expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 2 with image from Shanaka et al., 2023
defense response to virus decreased efficacy, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 5 from Shanaka et al., 2022
whole organism decreased life span, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 5 from Shanaka et al., 2022
whole organism nox1 expression increased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 3 with image from Shanaka et al., 2023
whole organism nox1 expression increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 3 with image from Shanaka et al., 2023
whole organism cholesterol increased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 2 with image from Shanaka et al., 2023
whole organism ldha expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 2 with image from Shanaka et al., 2023
whole organism ifnphi3 expression increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 6 from Shanaka et al., 2022
whole organism decreased life span, exacerbated rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 1 with image from Shanaka et al., 2023
whole organism csf1a expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 3 with image from Shanaka et al., 2023
whole organism cmpk2 expression increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 6 from Shanaka et al., 2022
whole organism viability, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Fig. 5 from Shanaka et al., 2022
whole organism fasn expression increased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 2 with image from Shanaka et al., 2023
whole organism ldha expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 2 with image from Shanaka et al., 2023
whole organism hif1aa expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) control Figure 2 with image from Shanaka et al., 2023
whole organism cholesterol increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 2 with image from Shanaka et al., 2023
defense response to virus decreased efficacy, exacerbated rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 1 with image from Shanaka et al., 2023
defense response to virus decreased efficacy, abnormal rsad2zf4050/zf4050 (AB) viral treatment: Viral hemorrhagic septicemia virus, amputation: caudal fin Fig. 5 from Shanaka et al., 2022
whole organism mpx expression increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 3 with image from Shanaka et al., 2023
whole organism sod1 expression decreased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment by injection: Viral hemorrhagic septicemia virus Figure 2 with image from Shanaka et al., 2023
neutrophil increased amount, abnormal rsad2zf4050/zf4050 (AB) viral treatment: Viral hemorrhagic septicemia virus, amputation: caudal fin Fig. 5 from Shanaka et al., 2022
macrophage response to wounding decreased occurrence, abnormal rsad2zf4050/zf4050; gl22Tg chemical treatment by environment: poly(I:C), amputation: caudal fin Figure 3 with image from Shanaka et al., 2023
caudal fin macrophage decreased amount, abnormal rsad2zf4050/zf4050; gl22Tg chemical treatment by environment: poly(I:C), amputation: caudal fin Figure 3 with image from Shanaka et al., 2023
neutrophil response to wounding increased occurrence, abnormal rsad2zf4050/zf4050; uwm7Tg chemical treatment by environment: poly(I:C), amputation: caudal fin Figure 3 with image from Shanaka et al., 2023
neutrophil chemotaxis increased occurrence, abnormal rsad2zf4050/zf4050; uwm7Tg chemical treatment by environment: poly(I:C), amputation: caudal fin Figure 3 with image from Shanaka et al., 2023
caudal fin neutrophil increased amount, abnormal rsad2zf4050/zf4050; uwm7Tg chemical treatment by environment: poly(I:C), amputation: caudal fin Figure 3 with image from Shanaka et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.