CRISPR

CRISPR3-hnrnpa1a

ID
ZDB-CRISPR-250318-7
Name
CRISPR3-hnrnpa1a
Previous Names
None
Target
Sequence
5' - GCAGGAAACTTCGGAGGTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mde14 hnrnpa1a
mde17 hnrnpa3
Expression
Gene expression in Wild Types + CRISPR3-hnrnpa1a
No data available
Phenotype
Phenotype resulting from CRISPR3-hnrnpa1a
No data available
Phenotype of all Fish created by or utilizing CRISPR3-hnrnpa1a
Phenotype Fish Conditions Figures
brain hnrnpa1a expression decreased amount, abnormal hnrnpa1amde14/mde14 standard conditions FIGURE 1 with image from Jansen et al., 2026
spinal cord apoptotic process increased occurrence, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with image from Jansen et al., 2026
whole organism gadd45aa expression increased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
whole organism gpnmb expression decreased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
CaP motoneuron axon decreased length, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with image from Jansen et al., 2026
whole organism Ab1-hnrnpa1 labeling decreased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with image from Jansen et al., 2026
extension decreased thickness, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with image from Jansen et al., 2026
whole organism ldlrap1b expression increased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
whole organism rbl2 expression increased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
whole organism apoda.1 expression decreased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
somite ab1-actn labeling decreased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with image from Jansen et al., 2026
whole organism cdkn1a expression increased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
whole organism tp53 expression increased amount, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
regulation of lipid metabolic process decreased process quality, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 6 with image from Jansen et al., 2026
extension lipid droplet formation decreased occurrence, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 4 with image from Jansen et al., 2026
somite muscle cell degenerate, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with image from Jansen et al., 2026
blood circulation decreased efficacy, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 3 with imageFIGURE 5 with image from Jansen et al., 2026
extension decreased area, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 4 with image from Jansen et al., 2026
lipid transport decreased process quality, abnormal hnrnpa1bmde16/mde16; hnrnpa1amde14/mde14 standard conditions FIGURE 5 with image from Jansen et al., 2026
Citations