CRISPR

CRISPR1-si:ch211-229n2.6

ID
ZDB-CRISPR-250314-1
Name
CRISPR1-si:ch211-229n2.6
Previous Names
None
Target
Sequence
5' - GGTTGGCTACTCACACTGGGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
vu716 si:ch211-229n2.6
Expression
Gene expression in Wild Types + CRISPR1-si:ch211-229n2.6
No data available
Phenotype
Phenotype resulting from CRISPR1-si:ch211-229n2.6
No data available
Phenotype of all Fish created by or utilizing CRISPR1-si:ch211-229n2.6
No data available
Citations