CRISPR
CRISPR1-si:ch211-229n2.6
- ID
- ZDB-CRISPR-250314-1
- Name
- CRISPR1-si:ch211-229n2.6
- Previous Names
- None
- Target
- Sequence
-
5' - GGTTGGCTACTCACACTGGGGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The first two "G"s were added.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
| Genomic Feature | Affected Genomic Regions |
|---|---|
| vu716 | si:ch211-229n2.6 |
Expression
Gene expression in Wild Types + CRISPR1-si:ch211-229n2.6
No data available
Phenotype
Phenotype resulting from CRISPR1-si:ch211-229n2.6
No data available
Phenotype of all Fish created by or utilizing CRISPR1-si:ch211-229n2.6
No data available
Citations