CRISPR

CRISPR2-fbln2

ID
ZDB-CRISPR-250130-2
Name
CRISPR2-fbln2
Previous Names
None
Target
Sequence
5' - GGTACAGACCGAATGAGAGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4237 fbln2
Expression
Gene expression in Wild Types + CRISPR2-fbln2
No data available
Phenotype
Phenotype resulting from CRISPR2-fbln2
Phenotype Fish Figures
ceratobranchial cartilage absence of anatomical entity, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
ceratobranchial cartilage deformed, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
ceratohyal cartilage increased width, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
head dorsal region apoptotic, abnormal y1Tg + CRISPR2-fbln2 (TU) Fig. 8 with image from Niu et al., 2024
Meckel's cartilage absence of anatomical entity, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
Meckel's cartilage increased width, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
Meckel's cartilage position, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
palatoquadrate cartilage decreased length, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
pericardium edematous, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
pharyngeal arch apoptotic, abnormal y1Tg + CRISPR2-fbln2 (TU) Fig. 8 with image from Niu et al., 2024
pharyngeal arch Ab47-h3 labeling decreased distribution, abnormal y1Tg + CRISPR2-fbln2 (TU) Fig. 8 with image from Niu et al., 2024
pharyngeal arch cell population proliferation decreased process quality, abnormal y1Tg + CRISPR2-fbln2 (TU) Fig. 8 with image from Niu et al., 2024
swim bladder uninflated, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
ventral mandibular arch atrophied, abnormal TU + CRISPR2-fbln2 Fig. 5 with image from Niu et al., 2024
Phenotype of all Fish created by or utilizing CRISPR2-fbln2
Phenotype Fish Conditions Figures
Meckel's cartilage absence of anatomical entity, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
pharyngeal arch col2a1a expression decreased distribution, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 7 with image from Niu et al., 2024
ceratobranchial cartilage deformed, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
pharyngeal arch sox9a expression decreased distribution, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 7 with image from Niu et al., 2024
Meckel's cartilage position, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
Meckel's cartilage increased width, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
ceratohyal cartilage increased width, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
swim bladder uninflated, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
palatoquadrate cartilage decreased length, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
pericardium edematous, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
ventral mandibular arch atrophied, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
ceratobranchial cartilage absence of anatomical entity, abnormal fbln2zf4237/zf4237 (TU) standard conditions Fig. 5 with image from Niu et al., 2024
ventral mandibular arch atrophied, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
Meckel's cartilage absence of anatomical entity, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
ceratobranchial cartilage deformed, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
Meckel's cartilage position, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
Meckel's cartilage increased width, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
ceratohyal cartilage increased width, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
swim bladder uninflated, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
palatoquadrate cartilage decreased length, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
pericardium edematous, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
ceratobranchial cartilage absence of anatomical entity, abnormal TU + CRISPR2-fbln2 control Fig. 5 with image from Niu et al., 2024
pharyngeal arch Ab47-h3 labeling decreased distribution, abnormal y1Tg + CRISPR2-fbln2 (TU) control Fig. 8 with image from Niu et al., 2024
pharyngeal arch cell population proliferation decreased process quality, abnormal y1Tg + CRISPR2-fbln2 (TU) control Fig. 8 with image from Niu et al., 2024
pharyngeal arch apoptotic, abnormal y1Tg + CRISPR2-fbln2 (TU) control Fig. 8 with image from Niu et al., 2024
head dorsal region apoptotic, abnormal y1Tg + CRISPR2-fbln2 (TU) control Fig. 8 with image from Niu et al., 2024
cranial cartilage chondrocyte decreased size, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 5 with image from Niu et al., 2024
pharyngeal arch Ab47-h3 labeling decreased distribution, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 8 with image from Niu et al., 2024
pharyngeal arch cell population proliferation decreased process quality, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 8 with image from Niu et al., 2024
pharyngeal arch Ab13-smad labeling decreased distribution, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 9 with image from Niu et al., 2024
cranial cartilage chondrocyte organization quality, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 5 with image from Niu et al., 2024
pharyngeal arch apoptotic, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 8 with image from Niu et al., 2024
head dorsal region apoptotic, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 8 with image from Niu et al., 2024
cranial cartilage chondrocyte disorganized, abnormal fbln2zf4237/zf4237; y1Tg (TU) standard conditions Fig. 5 with image from Niu et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.