CRISPR

CRISPR2-msantd2

ID
ZDB-CRISPR-250117-6
Name
CRISPR2-msantd2
Previous Names
  • CRISPR2-si:ch211-80m8.2
Target
Sequence
5' - GTGTTTTCTGGCAAGGCTCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-msantd2
No data available
Phenotype
Phenotype resulting from CRISPR2-msantd2
No data available
Phenotype of all Fish created by or utilizing CRISPR2-msantd2
Phenotype Fish Conditions Figures
head decreased size, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image from Etchegaray et al., 2022
forebrain fgf8a expression spatial pattern, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
hindbrain neuron pax2a expression absent, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
tectal ventricle decreased size, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image from Etchegaray et al., 2022
nervous system malformed, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image,  Fig. S8 from Etchegaray et al., 2022
somite morphology, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image,  Fig. S8 from Etchegaray et al., 2022
chordate embryonic development delayed, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. S8 from Etchegaray et al., 2022
midbrain hindbrain boundary malformed, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image from Etchegaray et al., 2022
midbrain hindbrain boundary pax2a expression decreased amount, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
post-vent region malformed, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. S8 from Etchegaray et al., 2022
telencephalon dlx2a expression decreased amount, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
forebrain ventricle decreased size, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image from Etchegaray et al., 2022
post-vent region increased curvature, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image,  Fig. S8 from Etchegaray et al., 2022
midbrain hindbrain boundary fgf8a expression decreased amount, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
midbrain hindbrain boundary her5 expression decreased amount, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
chordate embryonic development decreased process quality, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image from Etchegaray et al., 2022
neural tube formation process quality, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image,  Fig. S8 from Etchegaray et al., 2022
nervous system development process quality, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 6 with image,  Fig. 7 with image from Etchegaray et al., 2022
pharyngeal arch dlx2a expression decreased amount, abnormal AB/TU + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
cell death increased occurrence, abnormal a13203Tg + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
nervous system development process quality, abnormal a13203Tg + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. 7 with image from Etchegaray et al., 2022
migratory neural crest cell anatomical structure quality, abnormal vu234Tg + CRISPR1-msantd2 + CRISPR2-msantd2 + CRISPR3-msantd2 + CRISPR4-msantd2 standard conditions Fig. S8 from Etchegaray et al., 2022
Citations