CRISPR

CRISPR1-nkx1-2a

ID
ZDB-CRISPR-250116-14
Name
CRISPR1-nkx1-2a
Previous Names
  • CRISPR1-nkx1.2la
Target
Sequence
5' - GGAAAGGTACATCGGACCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ouc1005 nkx1-2a
Expression
Gene expression in Wild Types + CRISPR1-nkx1-2a
No data available
Phenotype
Phenotype resulting from CRISPR1-nkx1-2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-nkx1-2a
Phenotype Fish Conditions Figures
adipose tissue acaca expression decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
blood plasma cholesterol decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) fasting Fig. 3 with image from Wang et al., 2024
liver cebpa expression decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
adipose tissue fasn expression decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
yolk lipid decreased distribution, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 3 with image from Wang et al., 2024
adipose tissue cebpa expression decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
adipose tissue ucp2 expression increased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
liver cholesterol decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) fasting Fig. 3 with image from Wang et al., 2024
gut lipid droplet decreased distribution, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 3 with image from Wang et al., 2024
whole organism decreased weight, abnormal nkx1-2aouc1005/ouc1005 (AB) high fat Fig. 3 with image from Wang et al., 2024
yolk lipid increased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 3 with image from Wang et al., 2024
liver ucp2 expression increased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
liver triglyceride decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) fasting Fig. 3 with image from Wang et al., 2024
liver lipid decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) fasting Fig. 3 with image from Wang et al., 2024
liver acaca expression decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
visceral fat decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) fasting Fig. 3 with image from Wang et al., 2024
liver fasn expression decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 4 with image from Wang et al., 2024
gut lipid droplet decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) standard conditions Fig. 3 with image from Wang et al., 2024
blood plasma triglyceride decreased amount, abnormal nkx1-2aouc1005/ouc1005 (AB) fasting Fig. 3 with image from Wang et al., 2024
Citations