CRISPR

CRISPR2-egln1b

ID

ZDB-CRISPR-250102-15

Name

CRISPR2-egln1b

Previous Names

None

Target

egln1b (1)

Sequence

5' - GGAAGGAGCCCGGCTGTGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ouc406	egln1b
ouc407	egln1b

Expression

Gene expression in Wild Types + CRISPR2-egln1b

No data available

Phenotype

Phenotype resulting from CRISPR2-egln1b

No data available

Phenotype of all Fish created by or utilizing CRISPR2-egln1b

Phenotype	Fish	Conditions	Figures
whole organism egln3 expression increased amount, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
opercular flap increased mobility, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 4 from Dou et al., 2024
whole organism hif1ab expression increased amount, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism ppp1r15a expression increased amount, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism hif1ab expression increased amount, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism il11a expression increased amount, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism egln1b expression decreased amount, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 1 from Dou et al., 2024
nucleate erythrocyte development disrupted, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 5 from Dou et al., 2024
heart contraction increased frequency, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 4 from Dou et al., 2024
nucleate erythrocyte increased amount, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 5 from Dou et al., 2024
blood circulation increased rate, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 4 from Dou et al., 2024
positive regulation of hypoxia-inducible factor-1alpha signaling pathway increased occurrence, exacerbated	egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism dead, ameliorated	egln1b^{ouc407/ouc407}	hypoxia	Fig. 2 from Dou et al., 2024
whole organism egln3 expression increased amount, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism serpine1 expression increased amount, abnormal	egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism epoa expression increased amount, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 5 from Dou et al., 2024
positive regulation of hypoxia-inducible factor-1alpha signaling pathway increased occurrence, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
ventricular myocardium increased thickness, abnormal	egln1b^{ouc407/ouc407}	standard conditions	Fig. 4 from Dou et al., 2024
liver lipid increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 4 from Dou et al., 2024
whole organism il11a expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism decreased length, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 2 from Dou et al., 2024
opercular flap increased mobility, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 4 from Dou et al., 2024
whole organism hif1ab expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism egln3 expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism hif1ab expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism ppp1r15a expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism serpine1 expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism il11a expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism egln1b expression decreased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 1 from Dou et al., 2024
nucleate erythrocyte development disrupted, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 5 from Dou et al., 2024
heart contraction increased frequency, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 4 from Dou et al., 2024
whole organism dead, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 1 from Dou et al., 2024
whole organism egln1a expression decreased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 1 from Dou et al., 2024
nucleate erythrocyte increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 5 from Dou et al., 2024
liver inflamed, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 4 from Dou et al., 2024
whole organism ppp1r15a expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
blood circulation increased rate, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 4 from Dou et al., 2024
positive regulation of hypoxia-inducible factor-1alpha signaling pathway increased occurrence, exacerbated	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
whole organism dead, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 2 from Dou et al., 2024
whole organism egln3 expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism epoa expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 5 from Dou et al., 2024
whole organism serpine1 expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	hypoxia	Fig. 3 from Dou et al., 2024
ventricular myocardium increased thickness, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 4 from Dou et al., 2024
positive regulation of hypoxia-inducible factor-1alpha signaling pathway increased occurrence, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024
whole organism igfbp1b expression increased amount, abnormal	egln1a^{ouc404/ouc404}; egln1b^{ouc407/ouc407}	standard conditions	Fig. 3 from Dou et al., 2024

Citations