CRISPR

CRISPR1-polg2

ID

ZDB-CRISPR-241211-2

Name

CRISPR1-polg2

Previous Names

None

Target

polg2 (1)

Sequence

5' - GGGCGATGAGAGTTTGAAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ia304	polg2

Expression

Gene expression in Wild Types + CRISPR1-polg2

No data available

Phenotype

Phenotype resulting from CRISPR1-polg2

No data available

Phenotype of all Fish created by or utilizing CRISPR1-polg2

Phenotype	Fish	Conditions	Figures
skeletal muscle cell morphology, abnormal	polg2^ia304/ia304	standard conditions	Fig. 3 from Brañas Casas et al., 2024
skeletal muscle cell mitochondrial crista increased distance skeletal muscle cell mitochondrial crista, abnormal	polg2^ia304/ia304	standard conditions	Fig. 3 from Brañas Casas et al., 2024
whole organism polg expression increased amount, abnormal	polg2^ia304/ia304	standard conditions	Fig. 1 from Brañas Casas et al., 2024
phototaxis decreased process quality, abnormal	polg2^ia304/ia304	control	Fig. 5 from Brañas Casas et al., 2024
skeletal muscle cell disorganized, abnormal	polg2^ia304/ia304	standard conditions	Fig. 3 from Brañas Casas et al., 2024
heart trabecular layer decreased thickness, abnormal	polg2^ia304/ia304	standard conditions	Fig. 3 from Brañas Casas et al., 2024
phototaxis process quality, ameliorated	polg2^ia304/ia304	chemical treatment by environment: Clofilium	Fig. 5 from Brañas Casas et al., 2024
whole organism locomotory behavior decreased occurrence, abnormal	polg2^ia304/ia304	standard conditions	Fig. 2 from Brañas Casas et al., 2024
whole organism mitochondrial chromosome decreased amount, abnormal	polg2^ia304/ia304	standard conditions	Fig. 4 , Fig. 5 from Brañas Casas et al., 2024
aerobic respiration decreased occurrence, abnormal	polg2^ia304/ia304	standard conditions	Fig. 4 from Brañas Casas et al., 2024
whole organism decreased life span, abnormal	polg2^ia304/ia304	standard conditions	Fig. 1 from Brañas Casas et al., 2024
skeletal muscle cell mitochondrion morphology, abnormal	polg2^ia304/ia304	standard conditions	Fig. 3 from Brañas Casas et al., 2024
whole organism mitochondrial chromosome amount, ameliorated	polg2^ia304/ia304	chemical treatment by environment: Clofilium	Fig. 5 from Brañas Casas et al., 2024
whole organism decreased length, abnormal	polg2^ia304/ia304	standard conditions	Fig. 1 from Brañas Casas et al., 2024
whole organism viability, abnormal	polg2^ia304/ia304	standard conditions	Fig. 1 from Brañas Casas et al., 2024
whole organism polg2 expression decreased amount, abnormal	polg2^ia304/ia304	standard conditions	Fig. 1 from Brañas Casas et al., 2024
whole organism polg expression increased amount, abnormal	polg2^ia304/+	standard conditions	Fig. 1 from Brañas Casas et al., 2024
whole organism polg2 expression decreased amount, abnormal	polg2^ia304/+	standard conditions	Fig. 1 from Brañas Casas et al., 2024
hypoxia-inducible factor-1alpha signaling pathway increased occurrence, abnormal	polg2^ia304/+; ia21Tg	standard conditions	Fig. 4 from Brañas Casas et al., 2024
skeletal muscle cell mitochondrion decreased mass, abnormal	polg2^ia304/+; ia301Tg	standard conditions	Fig. 4 from Brañas Casas et al., 2024
hypoxia-inducible factor-1alpha signaling pathway increased occurrence, abnormal	polg2^ia304/ia304; ia21Tg	standard conditions	Fig. 4 from Brañas Casas et al., 2024
skeletal muscle cell mitochondrion decreased mass, abnormal	polg2^ia304/ia304; ia301Tg	standard conditions	Fig. 4 from Brañas Casas et al., 2024

Citations