CRISPR

CRISPR1-ogdhl

ID
ZDB-CRISPR-240916-7
Name
CRISPR1-ogdhl
Previous Names
None
Target
Sequence
5' - TCCTAATGCCCTGGTGTGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR1-ogdhl
No data available
Phenotype
Phenotype resulting from CRISPR1-ogdhl
No data available
Phenotype of all Fish created by or utilizing CRISPR1-ogdhl
Phenotype Fish Conditions Figures
whole organism decreased length, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S6 from Lin et al., 2023
whole organism casp9 expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S8 from Lin et al., 2023
whole organism dhtkd1 expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S6 from Lin et al., 2023
head decreased size, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S3 from Lin et al., 2023
whole organism fosab expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S8 from Lin et al., 2023
eye decreased size, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S3 from Lin et al., 2023
hindbrain apoptotic process increased occurrence, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 5 with image from Lin et al., 2023
whole organism casp8 expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S8 from Lin et al., 2023
heart edematous, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S3 from Lin et al., 2023
whole organism mdm2 expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S8 from Lin et al., 2023
whole organism ogdha expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S6 from Lin et al., 2023
whole organism ogdhb expression increased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S6 from Lin et al., 2023
spinal cord apoptotic process increased occurrence, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 5 with image from Lin et al., 2023
eye apoptotic process increased occurrence, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 5 with image from Lin et al., 2023
whole organism ogdhl expression decreased amount, abnormal NHGRI-1 + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. S6 from Lin et al., 2023
CaP motoneuron decreased angle to spinal cord, abnormal ml2Tg; vu19Tg + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 6 with image from Lin et al., 2023
CaP motoneuron decreased length, abnormal ml2Tg; vu19Tg + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 6 with image from Lin et al., 2023
CaP motoneuron decreased thickness, abnormal ml2Tg; vu19Tg + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 6 with image from Lin et al., 2023
CaP motoneuron morphology, abnormal ml2Tg; vu19Tg + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 6 with image from Lin et al., 2023
axon guidance disrupted, abnormal ml2Tg; vu19Tg + CRISPR1-ogdhl + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 6 with image from Lin et al., 2023
head decreased size, exacerbated NHGRI-1 + CRISPR1-ogdha + CRISPR1-ogdhb + CRISPR1-ogdhl + CRISPR2-ogdha + CRISPR2-ogdhb + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 4 with image from Lin et al., 2023
eye decreased size, exacerbated NHGRI-1 + CRISPR1-ogdha + CRISPR1-ogdhb + CRISPR1-ogdhl + CRISPR2-ogdha + CRISPR2-ogdhb + CRISPR2-ogdhl + CRISPR3-ogdhl standard conditions Fig. 4 with image from Lin et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.