CRISPR

CRISPR2-mapk7

ID
ZDB-CRISPR-240823-1
Name
CRISPR2-mapk7
Previous Names
  • exon 3 (1)
Target
Sequence
5' - GGGGACTTCGGAATGGCACG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
syu501 mapk7
zko2842B mapk7
Expression
Gene expression in Wild Types + CRISPR2-mapk7
No data available
Phenotype
Phenotype resulting from CRISPR2-mapk7
No data available
Phenotype of all Fish created by or utilizing CRISPR2-mapk7
Phenotype Fish Conditions Figures
intestinal bulb fabp2 expression increased distribution, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 3 from Lv et al., 2023
mid intestine fabp2 expression increased distribution, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 3 from Lv et al., 2023
whole organism dead, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 1 from Lv et al., 2023
intestinal epithelium zonula adherens immature, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 6 from Lv et al., 2023
whole organism deformed, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 1 from Lv et al., 2023
posterior intestine increased permeability, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 3 from Lv et al., 2023
intestinal mucosa decreased thickness, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 5 from Lv et al., 2023
whole organism timp2b expression increased amount, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 9 from Lv et al., 2023
intestine decreased thickness, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 4 from Lv et al., 2023
whole organism mmp9 expression increased amount, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 9 from Lv et al., 2023
whole organism mmp13a.1 expression increased amount, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 9 from Lv et al., 2023
intestine lumen morphology, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 4Fig. 5 from Lv et al., 2023
intestinal epithelium desmosome decreased distribution, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 6 from Lv et al., 2023
intestinal epithelium tight junction immature, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 6 from Lv et al., 2023
whole organism il1b expression increased amount, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 9 from Lv et al., 2023
intestine increased permeability, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 7 from Lv et al., 2023
intestine dysplastic, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 5 from Lv et al., 2023
enteric musculature decreased thickness, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 5 from Lv et al., 2023
whole organism lepb expression increased amount, abnormal mapk7syu501/syu501 (AB) standard conditions Fig. 9 from Lv et al., 2023
intestine increased permeability, abnormal mapk7syu501/+ (AB) chemical treatment by environment: dextran sulfate sodium Fig. 8 from Lv et al., 2023
Citations