CRISPR

CRISPR2-map3k20b

ID
ZDB-CRISPR-240808-9
Name
CRISPR2-map3k20b
Previous Names
  • CRISPR4-map3k20a,map3k20b
Target
Sequence
5' - GGTCCCACAGGATAAAGAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4005 map3k20b
Expression
Gene expression in Wild Types + CRISPR2-map3k20b
No data available
Phenotype
Phenotype resulting from CRISPR2-map3k20b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-map3k20b
Phenotype Fish Conditions Figures
skeletal muscle cell myofibril disorganized, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. 10 from Stonadge et al., 2023
post-vent region decreased length, abnormal map3k20bzf4005/zf4005 (AB) chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
skeletal muscle cell sarcomere disorganized, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. 10 from Stonadge et al., 2023
swimming decreased linear velocity, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. 9 from Stonadge et al., 2023
post-vent region morphology, ameliorated map3k20bzf4005/zf4005 (AB) chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
yolk syncytial layer structure, ameliorated map3k20bzf4005/zf4005 (AB) chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
locomotory behavior decreased process quality, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. 9 from Stonadge et al., 2023
swimming decreased occurrence, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. 9 from Stonadge et al., 2023
yolk syncytial layer color, abnormal map3k20bzf4005/zf4005 (AB) chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
whole organism map3k20b expression decreased amount, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. S3 from Snieckute et al., 2023
yolk syncytial layer color, ameliorated map3k20bzf4005/zf4005 (AB) chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
pericardium structure, ameliorated map3k20bzf4005/zf4005 (AB) chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
yolk syncytial layer structure, abnormal map3k20bzf4005/zf4005 (AB) chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
pericardium edematous, abnormal map3k20bzf4005/zf4005 (AB) chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
whole organism map3k20a expression decreased amount, abnormal map3k20bzf4005/zf4005 (AB) standard conditions Fig. S3 from Snieckute et al., 2023
post-vent region kinked, abnormal map3k20bzf4005/zf4005 (AB) chemical treatment by environment: menadione Fig. 3 with image from Snieckute et al., 2023
whole organism map3k20b expression decreased amount, abnormal map3k20azf4004/zf4004; map3k20bzf4005/zf4005 (AB) standard conditions Fig. S3 from Snieckute et al., 2023
whole organism map3k20a expression decreased amount, abnormal map3k20azf4004/zf4004; map3k20bzf4005/zf4005 (AB) standard conditions Fig. S3 from Snieckute et al., 2023
Citations