CRISPR
CRISPR2-map3k20b
- ID
- ZDB-CRISPR-240808-9
- Name
- CRISPR2-map3k20b
- Previous Names
-
- CRISPR4-map3k20a,map3k20b
- Target
- Sequence
-
5' - GGTCCCACAGGATAAAGAAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
Expression
Gene expression in Wild Types + CRISPR2-map3k20b
No data available
Phenotype
Phenotype resulting from CRISPR2-map3k20b
No data available
Phenotype of all Fish created by or utilizing CRISPR2-map3k20b
1 - 5 of 18 Show all
Citations
- Rodríguez-Ruiz, L., Lozano-Gil, J.M., Naranjo-Sánchez, E., Martínez-Balsalobre, E., Martínez-López, A., Lachaud, C., Blanquer, M., Phung, T.K., García-Moreno, D., Cayuela, M.L., Tyrkalska, S.D., Pérez-Oliva, A.B., Mulero, V. (2023) ZAKα/P38 kinase signaling pathway regulates hematopoiesis by activating the NLRP1 inflammasome. EMBO Molecular Medicine. 15(10):e18142
- Snieckute, G., Ryder, L., Vind, A.C., Wu, Z., Arendrup, F.S., Stoneley, M., Chamois, S., Martinez-Val, A., Leleu, M., Dreos, R., Russell, A., Gay, D.M., Genzor, A.V., Choi, B.S., Basse, A.L., Sass, F., Dall, M., Dollet, L.C.M., Blasius, M., Willis, A.E., Lund, A.H., Treebak, J.T., Olsen, J.V., Poulsen, S.S., Pownall, M.E., Jensen, B.A.H., Clemmensen, C., Gerhart-Hines, Z., Gatfield, D., Bekker-Jensen, S. (2023) ROS-induced ribosome impairment underlies ZAKα-mediated metabolic decline in obesity and aging. Science (New York, N.Y.). 382:eadf3208eadf3208
- Stonadge, A., Genzor, A.V., Russell, A., Hamed, M.F., Romero, N., Evans, G., Pownall, B., Bekker-Jensen, S., Blanco, G. (2023) Myofibrillar myopathy hallmarks associated with ZAK deficiency. Human molecular genetics. 32(17):2751-2770
1 - 3 of 3
Show