CRISPR

CRISPR1-map3k20b

ID

ZDB-CRISPR-240808-8

Name

CRISPR1-map3k20b

Previous Names

CRISPR3-map3k20a,map3k20b

Target

map3k20b (1)

Sequence

5' - GGAAAGGGATCTGAACGAAAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first "G" was added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf4005	map3k20b

Expression

Gene expression in Wild Types + CRISPR1-map3k20b

No data available

Phenotype

Phenotype resulting from CRISPR1-map3k20b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-map3k20b

Phenotype	Fish	Conditions	Figures
skeletal muscle cell myofibril disorganized, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. 10 from Stonadge et al., 2023
post-vent region decreased length, abnormal	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
skeletal muscle cell sarcomere disorganized, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. 10 from Stonadge et al., 2023
swimming decreased linear velocity, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. 9 from Stonadge et al., 2023
post-vent region morphology, ameliorated	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
yolk syncytial layer structure, ameliorated	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
locomotory behavior decreased process quality, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. 9 from Stonadge et al., 2023
swimming decreased occurrence, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. 9 from Stonadge et al., 2023
yolk syncytial layer color, abnormal	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
whole organism map3k20b expression decreased amount, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. S3 from Snieckute et al., 2023
yolk syncytial layer color, ameliorated	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
pericardium structure, ameliorated	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: N-acetyl-L-cysteine, chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
yolk syncytial layer structure, abnormal	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
pericardium edematous, abnormal	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
whole organism map3k20a expression decreased amount, abnormal	map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. S3 from Snieckute et al., 2023
post-vent region kinked, abnormal	map3k20b^{zf4005/zf4005} (AB)	chemical treatment by environment: menadione	Fig. 3 from Snieckute et al., 2023
whole organism map3k20b expression decreased amount, abnormal	map3k20a^{zf4004/zf4004}; map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. S3 from Snieckute et al., 2023
whole organism map3k20a expression decreased amount, abnormal	map3k20a^{zf4004/zf4004}; map3k20b^{zf4005/zf4005} (AB)	standard conditions	Fig. S3 from Snieckute et al., 2023

Citations