CRISPR

CRISPR1-bcl2l13

ID

ZDB-CRISPR-240716-2

Name

CRISPR1-bcl2l13

Previous Names

None

Target

bcl2l13 (1)

Sequence

5' - GGTCTTGATCTTGATGGCGAGGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ula2	bcl2l13

Expression

Gene expression in Wild Types + CRISPR1-bcl2l13

No data available

Phenotype

Phenotype resulting from CRISPR1-bcl2l13

No data available

Phenotype of all Fish created by or utilizing CRISPR1-bcl2l13

Phenotype	Fish	Conditions	Figures
skeletal muscle electron transport chain decreased rate, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 4 from Grepper et al., 2024
electron transport chain decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
cysteine-type peptidase activity increased occurrence, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
skeletal muscle calcium ion homeostasis decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 2 from Grepper et al., 2024
whole organism decreased length, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 1 from Grepper et al., 2024
transmembrane transporter activity decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
skeletal muscle sarcoplasmic reticulum tubular, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 2 from Grepper et al., 2024
reactive oxygen species biosynthetic process decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
skeletal muscle mitochondrion Ab2-itpr labeling increased distribution, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 4 from Grepper et al., 2024
proton transmembrane transporter activity decreased occurrence, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
muscle cell mitochondrion increased size, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 4 from Grepper et al., 2024
calcium-mediated signaling decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
cytochrome-c oxidase activity decreased occurrence, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
hydrolase activity, hydrolyzing O-glycosyl compounds increased occurrence, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
NAD+ metabolic process decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
swimming behavior decreased rate, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 1 from Grepper et al., 2024
fast muscle cell decreased area, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 2 from Grepper et al., 2024
whole organism decreased mass, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 1 from Grepper et al., 2024
threonine-type peptidase activity increased occurrence, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 3 from Grepper et al., 2024
regulation of oxygen metabolic process decreased process quality, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 1 from Grepper et al., 2024
muscle cell mitochondrion increased amount, abnormal	bcl2l13^ula2/ula2	standard conditions	Figure 4 from Grepper et al., 2024

Citations