CRISPR

CRISPR4-psap

ID
ZDB-CRISPR-240716-11
Name
CRISPR4-psap
Previous Names
None
Target
Sequence
5' - GACATTCTGGCACCAGTAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
f28 psap
f29 psap
Expression
Gene expression in Wild Types + CRISPR4-psap
No data available
Phenotype
Phenotype resulting from CRISPR4-psap
No data available
Phenotype of all Fish created by or utilizing CRISPR4-psap
Phenotype Fish Conditions Figures
brain mbpa expression decreased amount, abnormal psapf28/f28 standard conditions Fig. 3. with imageFig. 6. with imageFig. 7. with image from Zhang et al., 2023
brain gfap expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
lipid metabolic process process quality, abnormal psapf28/f28 standard conditions Fig. 2. with image from Zhang et al., 2023
brain nfkbiaa expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with imageFig. 7. with image from Zhang et al., 2023
brain stat3 expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
brain ptprc expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
brain il1b expression increased amount, abnormal psapf28/f28 chemical treatment by environment: monomethyl fumarate Fig. 7. with image from Zhang et al., 2023
brain ab2-eif4ebp1 labeling increased amount, abnormal psapf28/f28 standard conditions Fig. 5. with image from Zhang et al., 2023
locomotion decreased occurrence, abnormal psapf28/f28 standard conditions Fig. 3. with image from Zhang et al., 2023
brain tnfb expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with imageFig. 7. with image from Zhang et al., 2023
brain il1b expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with imageFig. 7. with image from Zhang et al., 2023
brain ab8-rps6k labeling decreased amount, abnormal psapf28/f28 standard conditions Fig. 5. with image from Zhang et al., 2023
whole organism decreased length, abnormal psapf28/f28 standard conditions Fig. 3. with image from Zhang et al., 2023
whole organism decreased life span, abnormal psapf28/f28 chemical treatment by environment: monomethyl fumarate Fig. 7. with image from Zhang et al., 2023
inflammatory response increased occurrence, abnormal psapf28/f28 standard conditions Fig. 4. with image from Zhang et al., 2023
brain cd68 expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with imageFig. 7. with image from Zhang et al., 2023
brain rbfox3a expression decreased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
brain ab1-eif4ebp1 labeling increased amount, abnormal psapf28/f28 standard conditions Fig. 5. with image from Zhang et al., 2023
swimming decreased linear velocity, abnormal psapf28/f28 standard conditions Fig. 3. with image from Zhang et al., 2023
brain mbpa expression decreased amount, abnormal psapf28/f28 chemical treatment by environment: monomethyl fumarate Fig. 7. with image from Zhang et al., 2023
brain socs1b expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
brain nfkbiaa expression increased amount, abnormal psapf28/f28 chemical treatment by environment: monomethyl fumarate Fig. 7. with image from Zhang et al., 2023
whole organism decreased life span, abnormal psapf28/f28 standard conditions Fig. 7. with image from Zhang et al., 2023
cranial nerve II myelination decreased occurrence, abnormal psapf28/f28 standard conditions Fig. 3. with image from Zhang et al., 2023
brain tnfb expression increased amount, abnormal psapf28/f28 chemical treatment by environment: monomethyl fumarate Fig. 7. with image from Zhang et al., 2023
brain gpnmb expression increased amount, abnormal psapf28/f28 standard conditions Table S3 from Zhang et al., 2023
brain socs1a expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
TORC1 signaling disrupted, abnormal psapf28/f28 standard conditions Fig. 5. with image from Zhang et al., 2023
brain cd68 expression increased amount, abnormal psapf28/f28 chemical treatment by environment: monomethyl fumarate Fig. 7. with image from Zhang et al., 2023
brain stat2 expression increased amount, abnormal psapf28/f28 standard conditions Fig. 6. with image from Zhang et al., 2023
brain sphingomyelin increased amount, abnormal psapf28/f28 standard conditions Fig. 2. with image from Zhang et al., 2023
brain ceramide increased amount, abnormal psapf28/f28 standard conditions Fig. 2. with image from Zhang et al., 2023
brain myelination decreased occurrence, abnormal psapf28/f28 standard conditions Fig. 3. with image from Zhang et al., 2023
brain ceramide increased amount, abnormal psapf29/f29 standard conditions Fig. S4 from Zhang et al., 2023
locomotion decreased occurrence, abnormal psapf29/f29 standard conditions Fig. 3. with image from Zhang et al., 2023
whole organism decreased length, abnormal psapf29/f29 standard conditions Fig. 3. with image from Zhang et al., 2023
swimming decreased linear velocity, abnormal psapf29/f29 standard conditions Fig. 3. with image from Zhang et al., 2023
brain sphingomyelin increased amount, abnormal psapf29/f29 standard conditions Fig. S4 from Zhang et al., 2023
lipid metabolic process process quality, abnormal psapf29/f29 standard conditions Fig. S4 from Zhang et al., 2023
whole organism life span, ameliorated smpd1f30/f30; psapf28/f28 standard conditions Fig. 7. with image from Zhang et al., 2023
Citations