CRISPR

CRISPR4-adgrl3.1

ID
ZDB-CRISPR-240703-2
Name
CRISPR4-adgrl3.1
Previous Names
None
Target
Sequence
5' - GCAAGAAGTGTGGGTGCGGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3892 adgrl3.1
Expression
Gene expression in Wild Types + CRISPR4-adgrl3.1
No data available
Phenotype
Phenotype resulting from CRISPR4-adgrl3.1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-adgrl3.1
Phenotype Fish Conditions Figures
whole organism (R)-prunasin increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism microcystin LF increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism lysophosphatidylcholine 20:1 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism 5-aminolevulinate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
habituation process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Fig. 2 with image from Fontana et al., 2023
telencephalon ab3-fosab labeling decreased distribution, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Fig. 3 with image from Þorsteinsson et al., 2025
whole organism indoxyl sulfate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
locomotory exploration behavior process quality, abnormal adgrl3.1zf3892/zf3892 control Fig. 1 with image from Fontana et al., 2023
regulation of behavior process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Fig. 2 with image from Þorsteinsson et al., 2025
whole organism Monobutylphthalate increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism lysophosphatidylcholine 22:1 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism 11-Deoxy prostaglandin F2 increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism pterin decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 3 from Grzymala et al., 2025
whole organism arachidonoyl amine decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism 4-(trimethylammonio)butanoate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism 3'-methoxyflavone increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism lysophosphatidylinositol 18:1 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 6 from Grzymala et al., 2025
whole organism 5-aminopentanoate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism 5-(2-hydroxyethyl)-4-methylthiazole decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism medroxyprogesterone increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 35:1 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism phosphatidylcholine 37:1 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism (5-hydroxyindol-3-yl)acetic acid increased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
whole organism 11-Deoxy prostaglandin F2 increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism lysophosphatidylcholine 18:2 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism xylitol decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 3 from Grzymala et al., 2025
whole organism xylitol increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism 4-(trimethylammonio)butanoate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism guanidinoacetate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
associative learning process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Fig. 2 with image from Þorsteinsson et al., 2025
whole organism phosphatidylcholine 44:7 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism xylitol increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism guanidinoacetate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism N-(2,4-dimethylphenyl)formamide increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism 5-aminopentanoate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism pterin increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism L-cystathionine decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 37:5 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 6 from Grzymala et al., 2025
whole organism alpha-phenylglycine increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 29:0 increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 6 from Grzymala et al., 2025
whole organism 3-(indol-3-yl)pyruvic acid increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 28:0 increased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
locomotory exploration behavior process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Fig. 1 with image from Fontana et al., 2023
whole organism fatty acid 20:4 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism phosphatidylethanolamine 44:12 zwitterion increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
regulation of behavior decreased process quality, abnormal adgrl3.1zf3892/zf3892 control Fig. 2 with image from Þorsteinsson et al., 2025
whole organism syringic acid increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism 5-(2-hydroxyethyl)-4-methylthiazole decreased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
whole organism phosphatidylcholine 37:5 decreased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
regulation of behavior process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Fig. 2 with image from Þorsteinsson et al., 2025
whole organism phosphatidylcholine 30:0 increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism 11-Deoxy prostaglandin F2 increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 29:0 increased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
whole organism Monobutylphthalate increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism 5-(2-hydroxyethyl)-4-methylthiazole decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 3 from Grzymala et al., 2025
whole organism lysophosphatidylinositol 18:1 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism phosphatidylcholine 44:7 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 6 from Grzymala et al., 2025
whole organism ritalinic acid decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 3 from Grzymala et al., 2025
whole organism lysophosphatidylcholine 14:0 increased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
associative learning decreased process quality, abnormal adgrl3.1zf3892/zf3892 control Fig. 2 with image from Þorsteinsson et al., 2025
whole organism phosphatidylcholine 29:0 increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism (R)-prunasin increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
habituation decreased process quality, abnormal adgrl3.1zf3892/zf3892 control Fig. 2 with image from Fontana et al., 2023
whole organism phosphatidylcholine 44:7 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 6 from Grzymala et al., 2025
whole organism 3-(indol-3-yl)pyruvic acid increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 40:3 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism PC(20:4_22:6) increased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
whole organism fatty acid 20:4 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 6 from Grzymala et al., 2025
whole organism phosphatidylcholine 42:7 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism xylitol increased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
whole organism xylitol increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism 4-(trimethylammonio)butanoate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism arachidonoyl amine increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 3 from Grzymala et al., 2025
associative learning process quality, ameliorated adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Fig. 2 with image from Þorsteinsson et al., 2025
whole organism phosphatidylcholine 44:7 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 6 from Grzymala et al., 2025
whole organism phosphatidylcholine 38:8 decreased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
telencephalon ab3-fosab labeling decreased distribution, abnormal adgrl3.1zf3892/zf3892 control Fig. 3 with image from Þorsteinsson et al., 2025
whole organism L-cystathionine decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: Guanfacine Table 3 from Grzymala et al., 2025
whole organism 5-(2-hydroxyethyl)-4-methylthiazole decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism guanidinoacetate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 40:2 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism guanidinoacetate increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: methylphenidate Table 3 from Grzymala et al., 2025
whole organism phosphatidylcholine 42:6 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism guanidinoacetate decreased amount, abnormal adgrl3.1zf3892/zf3892 standard conditions Fig. 1 with image from Grzymala et al., 2025
whole organism 5-aminopentanoate decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: amlodipine Table 3 from Grzymala et al., 2025
whole organism PE(18:0_22:5) increased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
whole organism lysophosphatidylinositol 20:4 decreased amount, abnormal adgrl3.1zf3892/zf3892 chemical treatment by environment: atomoxetine Table 6 from Grzymala et al., 2025
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: aceclofenac Fig. 3 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: pyrroline Fig. 5 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: amlodipine Fig. 3 with image from Sveinsdóttir et al., 2022
social behavior process quality, abnormal adgrl3.1zf3892/zf3892 (AB) undercrowding Fig. 4 from Fontana et al., 2024
locomotory behavior increased process quality, abnormal adgrl3.1zf3892/zf3892 (AB) lighting conditions Fig. 1 with imageFig. 2 with imageFig. 3 with imageFig. 5 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: clonidine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: Guanfacine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: aceclofenac Fig. 3 with image from Sveinsdóttir et al., 2022
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: doxazosin Fig. 3 with image from Sveinsdóttir et al., 2022
cognition process quality, abnormal adgrl3.1zf3892/zf3892 (AB) undercrowding Fig. 3 from Fontana et al., 2024
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: Moxonidine Fig. 3 with image from Sveinsdóttir et al., 2022
social behavior process quality, abnormal adgrl3.1zf3892/zf3892 (AB) control Fig. 4 from Fontana et al., 2024
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: Moxonidine Fig. 3 with image from Sveinsdóttir et al., 2022
cognition process quality, abnormal adgrl3.1zf3892/zf3892 (AB) control Fig. 3 from Fontana et al., 2024
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: Guanfacine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: atomoxetine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: amlodipine Fig. 3 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: doxazosin Fig. 3 with image from Sveinsdóttir et al., 2022
swimming behavior decreased process quality, abnormal adgrl3.1zf3892/zf3892 (AB) control Fig. 2 from Fontana et al., 2024
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: atomoxetine Fig. 2 with image from Sveinsdóttir et al., 2022
locomotory behavior process quality, ameliorated adgrl3.1zf3892/zf3892 (AB) lighting conditions, chemical treatment by environment: clonidine Fig. 2 with image from Sveinsdóttir et al., 2022
swimming behavior decreased process quality, abnormal adgrl3.1zf3892/zf3892 (AB) undercrowding Fig. 2 from Fontana et al., 2024
sleep process quality, abnormal adgrl3.1zf3892/zf3892 (AB) chemical treatment by environment: pyrroline Fig. 5 with image from Sveinsdóttir et al., 2022
Citations