CRISPR

CRISPR1-baz1b

ID
ZDB-CRISPR-240220-4
Name
CRISPR1-baz1b
Previous Names
None
Target
Sequence
5' - CTCATCCTCCACCACCCAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
qm1 baz1b
qm2 baz1b
Expression
Gene expression in Wild Types + CRISPR1-baz1b
No data available
Phenotype
Phenotype resulting from CRISPR1-baz1b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-baz1b
Phenotype Fish Conditions Figures
habituation increased process quality, abnormal baz1bqm1/qm1 (TU) altered light dark cycle Fig. 3 with image from Torres-Pérez et al., 2022
eye increased width, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
whole organism sox2 expression increased amount, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
chordate embryonic development delayed, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
eye increased length, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
habituation increased process quality, abnormal baz1bqm1/qm1 (TU) acoustic radiation Fig. 4 with image from Torres-Pérez et al., 2022
whole organism crestin expression increased amount, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
cranial skeletal system development process quality, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
whole organism sox10 expression increased amount, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
whole organism decreased length, abnormal baz1bqm1/qm1 (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
whole organism sox2 expression decreased amount, abnormal baz1bqm1/+ (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
eye increased width, abnormal baz1bqm1/+ (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
whole organism decreased pigmentation, abnormal baz1bqm1/+ (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
habituation increased process quality, abnormal baz1bqm1/+ (TU) acoustic radiation Fig. 4 with image from Torres-Pérez et al., 2022
eye increased distance eye, abnormal baz1bqm1/+ (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
chordate embryonic development delayed, abnormal baz1bqm1/+ (TU) standard conditions Fig. 1 with image from Torres-Pérez et al., 2022
cranial skeletal system development process quality, abnormal baz1bqm1/+ (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
eye decreased distance eye, abnormal baz1bqm1/+ (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
whole organism decreased length, abnormal baz1bqm1/+ (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
eye increased distance snout, abnormal baz1bqm1/+ (TU) standard conditions Fig. 2 with image from Torres-Pérez et al., 2022
habituation increased process quality, abnormal baz1bqm1/+ (TU) lighting conditions Fig. 4 with image from Torres-Pérez et al., 2022
Citations