CRISPR

CRISPR6-bcl6aa

ID

ZDB-CRISPR-240117-3

Name

CRISPR6-bcl6aa

Previous Names

None

Target

bcl6aa (1)

Sequence

5' - GGTCCAGACTGATGGCGTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
mdu21	bcl6aa

Expression

Gene expression in Wild Types + CRISPR6-bcl6aa

No data available

Phenotype

Phenotype resulting from CRISPR6-bcl6aa

No data available

Phenotype of all Fish created by or utilizing CRISPR6-bcl6aa

Phenotype	Fish	Conditions	Figures
thymus ikzf1 expression decreased distribution, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 4 from Almohaisen et al., 2022
whole organism il1b expression increased amount, abnormal	bcl6aa^mdu21/mdu21	bacterial treatment by injection: Escherichia coli	Figure 6 from Almohaisen et al., 2022
whole organism dead, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 3 from Almohaisen et al., 2022
caudal fin macrophage migration decreased process quality, abnormal	bcl6aa^mdu21/mdu21	transection: caudal fin	Figure 5 from Almohaisen et al., 2022
thymus rag1 expression decreased distribution, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 4 from Almohaisen et al., 2022
thymus leukocyte decreased amount, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 4 from Almohaisen et al., 2022
thymus lcp1 expression decreased distribution, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 4 from Almohaisen et al., 2022
whole organism viability, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 3 from Almohaisen et al., 2022
whole organism activation of immune response decreased process quality, abnormal	bcl6aa^mdu21/mdu21	bacterial treatment by injection: Escherichia coli	Figure 6 from Almohaisen et al., 2022
whole organism ccr2 expression increased amount, abnormal	bcl6aa^mdu21/mdu21	control	Figure 6 from Almohaisen et al., 2022
whole organism decreased length, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 3 from Almohaisen et al., 2022
thymus T cell decreased amount, abnormal	bcl6aa^mdu21/mdu21	standard conditions	Figure 4 from Almohaisen et al., 2022
thymus ikzf1 expression decreased distribution, abnormal	bcl6aa^mdu21/+	standard conditions	Figure 4 from Almohaisen et al., 2022
thymus leukocyte decreased amount, abnormal	bcl6aa^mdu21/+	standard conditions	Figure 4 from Almohaisen et al., 2022
thymus rag1 expression decreased distribution, abnormal	bcl6aa^mdu21/+	standard conditions	Figure 4 from Almohaisen et al., 2022
thymus lcp1 expression decreased distribution, abnormal	bcl6aa^mdu21/+	standard conditions	Figure 4 from Almohaisen et al., 2022
whole organism decreased length, abnormal	bcl6aa^mdu21/+	standard conditions	Figure 3 from Almohaisen et al., 2022
thymus T cell decreased amount, abnormal	bcl6aa^mdu21/+	standard conditions	Figure 4 from Almohaisen et al., 2022
macrophage decreased amount, abnormal	bcl6aa^mdu21/+; gl22Tg	standard conditions	Figure 4 from Almohaisen et al., 2022
macrophage decreased amount, abnormal	bcl6aa^mdu21/mdu21; gl22Tg	standard conditions	Figure 4 from Almohaisen et al., 2022

Citations