CRISPR

CRISPR2-col9a1c

ID
ZDB-CRISPR-240103-3
Name
CRISPR2-col9a1c
Previous Names
None
Target
Sequence
5' - AGGGAGACACGCTGATCGGGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3677 col9a1c
Expression
Gene expression in Wild Types + CRISPR2-col9a1c
No data available
Phenotype
Phenotype resulting from CRISPR2-col9a1c
No data available
Phenotype of all Fish created by or utilizing CRISPR2-col9a1c
Phenotype Fish Conditions Figures
caudal fin vascular plexus increased size, abnormal col9a1czf3677/zf3677 standard conditions Fig. 6 with image from Nakagawa et al., 2021
caudal fin vascular plexus increased size, abnormal col9a1czf3677/zf3677 amputation: caudal fin Fig. 6 with image from Nakagawa et al., 2021
caudal fin shortened, abnormal col9a1czf3677/zf3677 standard conditions Fig. 2 with image from Nakagawa et al., 2021
caudal fin actinotrichium shortened, abnormal col9a1czf3677/zf3677 standard conditions Fig. 3 with image from Nakagawa et al., 2021
caudal fin dorsal-ventral axis shortened, abnormal col9a1czf3677/zf3677 standard conditions Fig. 2 with imageFig. 3 with image from Nakagawa et al., 2021
caudal fin principal ray curved medial, abnormal col9a1czf3677/zf3677 standard conditions Fig. 2 with image from Nakagawa et al., 2021
caudal fin actinotrichium morphogenesis of a branching structure decreased process quality, abnormal col9a1czf3677/zf3677 standard conditions Fig. 3 with image from Nakagawa et al., 2021
caudal fin circular, abnormal col9a1czf3677/zf3677 standard conditions Fig. 2 with image from Nakagawa et al., 2021
caudal fin actinotrichium shortened, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 4 with image from Nakagawa et al., 2021
caudal fin actinotrichium increased thickness, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 4 with image from Nakagawa et al., 2021
caudal fin actinotrichium disorganized, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg ultraviolet light, amputation: caudal fin Fig. 6 with image from Nakagawa et al., 2021
caudal fin dermal superficial region cell morphology, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 8 with image from Nakagawa et al., 2021
caudal fin vascular plexus disorganized, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg ultraviolet light, amputation: caudal fin Fig. 6 with image from Nakagawa et al., 2021
caudal fin actinotrichium disorganized, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 4 with imageFig. 7 with image from Nakagawa et al., 2021
caudal fin mesenchymal cell increased thickness, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 8 with image from Nakagawa et al., 2021
caudal fin basket cell morphology, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 8 with image from Nakagawa et al., 2021
caudal fin actinotrichium EGFP expression spatial pattern, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 4 with imageFig. 7 with image from Nakagawa et al., 2021
caudal fin mesenchymal cell positional polarity, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg standard conditions Fig. 8 with image from Nakagawa et al., 2021
caudal fin vascular plexus increased size, abnormal col9a1czf3677/zf3677; ou2106Tg/ou2106Tg ultraviolet light, amputation: caudal fin Fig. 6 with image from Nakagawa et al., 2021
Citations