CRISPR

CRISPR1-tmem39b

ID
ZDB-CRISPR-231218-4
Name
CRISPR1-tmem39b
Previous Names
None
Target
Sequence
5' - GGGCATGTCCAGTCCACCGT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zko3151a tmem39b
zko3151A tmem39b
zko3151b tmem39b
zko3151B tmem39b
Expression
Gene expression in Wild Types + CRISPR1-tmem39b
No data available
Phenotype
Phenotype resulting from CRISPR1-tmem39b
No data available
Phenotype of all Fish created by or utilizing CRISPR1-tmem39b
Phenotype Fish Conditions Figures
whole organism viability, exacerbated tmem39bzko3151a/zko3151a (AB) cold exposure Fig. S2 from Liu et al., 2022
whole organism rbp7a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) standard conditions Figure 5 with image from Liu et al., 2022
whole organism rbp7a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 5 with image from Liu et al., 2022
whole organism sting1 expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
gill lamella structure, exacerbated tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
whole organism mmp9 expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
whole organism Ab12-h2afx labeling increased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 6 with image from Liu et al., 2022
whole organism il11a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
whole organism bif1.2 expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 5 with image from Liu et al., 2022
whole organism socs3a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 5 with image from Liu et al., 2022
whole organism Ab54-h3 labeling increased amount, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 6 with image from Liu et al., 2022
whole organism rbp7a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
whole organism fosab expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 5 with image from Liu et al., 2022
whole organism bif1.2 expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
whole organism c3a.3 expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
whole organism socs3a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
whole organism fosab expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 5 with image from Liu et al., 2022
brain apoptotic process increased process quality, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
whole organism atf4a expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 7 with image from Liu et al., 2022
whole organism viability, exacerbated tmem39bzko3151b/zko3151b (AB) cold exposure Figure 2 with image from Liu et al., 2022
intestine microvillus structure, exacerbated tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
liver apoptotic process increased process quality, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
whole organism hspa5 expression increased amount, abnormal tmem39bzko3151b/zko3151b (AB) standard conditions Figure 7 with image from Liu et al., 2022
whole organism fosab expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) standard conditions Figure 5 with image from Liu et al., 2022
intestine apoptotic process increased process quality, abnormal tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
brain vacuole amount, exacerbated tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
liver vacuole amount, exacerbated tmem39bzko3151b/zko3151b (AB) cold exposure Figure 3 with image from Liu et al., 2022
whole organism xbp1 expression decreased amount, abnormal tmem39bzko3151b/zko3151b (AB) temperature exposure, cold exposure Figure 7 with image from Liu et al., 2022
whole organism viability, abnormal tmem39bzko3151a/+ (AB) cold exposure Fig. S2 from Liu et al., 2022
whole organism dead, abnormal tmem39bzko3151a/+ (AB) cold exposure Fig. S2 from Liu et al., 2022
Citations