CRISPR

CRISPR6-satb2

ID
ZDB-CRISPR-231003-2
Name
CRISPR6-satb2
Previous Names
None
Target
Sequence
5' - GGGCCCCGTTGTGACGACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
svn1 satb2
Expression
Gene expression in Wild Types + CRISPR6-satb2
No data available
Phenotype
Phenotype resulting from CRISPR6-satb2
No data available
Phenotype of all Fish created by or utilizing CRISPR6-satb2
Phenotype Fish Conditions Figures
head development decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 3 with image from Pradhan et al., 2021
whole organism viability, abnormal satb2svn1/svn1 standard conditions Fig. 1 with image from Pradhan et al., 2021
skeletal system morphogenesis decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
neuron differentiation decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
neural crest chromatin remodeling decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 4 with image from Pradhan et al., 2021
whole organism sox9b expression decreased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
whole organism zic1 expression decreased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
whole organism pax3a expression decreased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
whole organism id2a expression increased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
cranial skeletal system development decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 1 with image,  Fig. 2 with image from Pradhan et al., 2021
nervous system development decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 3 with image from Pradhan et al., 2021
chromatin binding decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
neural crest cell differentiation decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
neural crest id2a expression increased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
neural tube sox9a expression decreased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
chromatin organization decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
bone morphogenesis decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 1 with image from Pradhan et al., 2021
RNA metabolic process decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 3 with image from Pradhan et al., 2021
nucleobase-containing compound metabolic process decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 3 with image from Pradhan et al., 2021
ribosome biogenesis decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
brain development decreased process quality, abnormal satb2svn1/svn1 standard conditions Fig. 3 with image from Pradhan et al., 2021
head zic1 expression decreased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
whole organism sox10 expression decreased amount, abnormal satb2svn1/svn1 standard conditions Fig. 2 with image from Pradhan et al., 2021
endothelial cell nucleobase-containing compound metabolic process decreased process quality, abnormal satb2svn1/svn1; ba2Tg/ba2Tg standard conditions Fig. 3 with image from Pradhan et al., 2021
endothelial cell RNA metabolic process decreased process quality, abnormal satb2svn1/svn1; ba2Tg/ba2Tg standard conditions Fig. 3 with image from Pradhan et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.