CRISPR

CRISPR1-smad4a

ID

ZDB-CRISPR-231002-2

Name

CRISPR1-smad4a

Previous Names

None

Target

smad4a (1)

Sequence

5' - CGGCGCGGGACGGCGGGTGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fci101	smad4a

Expression

Gene expression in Wild Types + CRISPR1-smad4a

No data available

Phenotype

Phenotype resulting from CRISPR1-smad4a

No data available

Phenotype of all Fish created by or utilizing CRISPR1-smad4a

Phenotype	Fish	Conditions	Figures
whole organism ndr1 expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
BMP signaling pathway decreased magnitude, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 , Fig. 7 from Guglielmi et al., 2021
BMP signaling pathway decreased magnitude, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
whole organism lft2 expression decreased amount, abnormal	smad4a^{fci101/fci101}	chemical treatment by environment: SB 505124	Fig. 5 from Guglielmi et al., 2021
whole organism ndr2 expression decreased amount, abnormal	smad4a^{fci101/fci101}	chemical treatment by environment: SB 505124	Fig. 5 from Guglielmi et al., 2021
margin lft1 expression decreased amount, abnormal	smad4a^{fci101/fci101}	chemical treatment by environment: SB 505124	Fig. 4 from Guglielmi et al., 2021
margin lft1 expression spatial pattern, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 4 from Guglielmi et al., 2021
margin ndr1 expression spatial pattern, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 4 from Guglielmi et al., 2021
whole organism decreased length, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 1 from Guglielmi et al., 2021
whole organism decreased length, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 1 from Guglielmi et al., 2021
whole organism ndr2 expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
convergent extension involved in gastrulation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 6 from Guglielmi et al., 2021
whole organism eve1 expression increased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
whole organism lft1 expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
whole organism decreased length, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 1 from Guglielmi et al., 2021
axis elongation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 6 from Guglielmi et al., 2021
axis elongation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
axis elongation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
convergent extension involved in gastrulation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
whole organism dorsal side Ab13-smad labeling decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 3 from Guglielmi et al., 2021
convergent extension involved in gastrulation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
whole organism id3 expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
whole organism lft1 expression increased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
regulation of nodal signaling pathway sensitivity of a process mesoderm formation, abnormal	smad4a^{fci101/fci101}	chemical treatment by environment: SB 505124	Fig. 5 from Guglielmi et al., 2021
endoderm sox32 expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 5 from Guglielmi et al., 2021
whole organism lft2 expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
nodal signaling pathway decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
whole organism bmp4 expression increased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
whole organism gsc expression decreased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
cell migration involved in gastrulation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
cell migration involved in gastrulation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 7 from Guglielmi et al., 2021
margin Ab9-smad2 labeling increased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 4 from Guglielmi et al., 2021
whole organism smad1 expression increased amount, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 2 from Guglielmi et al., 2021
whole organism lft1 expression decreased amount, abnormal	smad4a^{fci101/fci101}	chemical treatment by environment: SB 505124	Fig. 5 from Guglielmi et al., 2021
cell migration involved in gastrulation decreased process quality, abnormal	smad4a^{fci101/fci101}	standard conditions	Fig. 6 from Guglielmi et al., 2021

Citations