CRISPR

CRISPR2-cfap20

ID

ZDB-CRISPR-230621-15

Name

CRISPR2-cfap20

Previous Names

None

Target

cfap20 (1)

Sequence

5' - GGAAAGGAAGCTTGATGCCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ua5025	cfap20

Expression

Gene expression in Wild Types + CRISPR2-cfap20

No data available

Phenotype

Phenotype resulting from CRISPR2-cfap20

No data available

Phenotype of all Fish created by or utilizing CRISPR2-cfap20

Phenotype	Fish	Conditions	Figures
retinal rod cell disorganized, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
post-vent region kinked, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
whole organism cfap20 expression decreased amount, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
vertebral column kinked, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
vertebral column increased curvature, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
retinal outer plexiform layer decreased thickness, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
photoreceptor outer segment layer area density, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
visual perception decreased process quality, abnormal	cfap20^{ua5025/ua5025} (AB)	lighting conditions	Fig. 7 from Chrystal et al., 2022
retinal photoreceptor layer apoptotic process increased process quality, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
pronephric duct cystic, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
vertebral column rotational curvature, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
vertebral column asymmetrically curved, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
retinal cone cell decreased length, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
determination of heart left/right asymmetry decreased process quality, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
retinal cone cell disorganized, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
post-vent region curved, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 2 from Chrystal et al., 2022
retinal rod cell decreased length, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
photoreceptor outer segment layer morphology, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
visual perception decreased process quality, abnormal	cfap20^{ua5025/ua5025} (AB)	lighting conditions	Fig. 7 from Chrystal et al., 2022
retinal photoreceptor layer ab5-casp3 labeling increased distribution, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
retinal photoreceptor layer decreased thickness, abnormal	cfap20^{ua5025/ua5025} (AB)	standard conditions	Fig. 7 from Chrystal et al., 2022
retinal cone cell decreased length, abnormal	cfap20^{ua5025/ua5025}; kj9Tg (AB)	standard conditions	Fig. S10 from Chrystal et al., 2022

Citations