CRISPR

CRISPR1-cfap20

ID
ZDB-CRISPR-230621-14
Name
CRISPR1-cfap20
Previous Names
None
Target
Sequence
5' - CGAATGTGAAATACTTCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ua5025 cfap20
Expression
Gene expression in Wild Types + CRISPR1-cfap20
No data available
Phenotype
Phenotype resulting from CRISPR1-cfap20
No data available
Phenotype of all Fish created by or utilizing CRISPR1-cfap20
Phenotype Fish Conditions Figures
retinal rod cell disorganized, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
post-vent region kinked, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
whole organism cfap20 expression decreased amount, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
vertebral column kinked, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
vertebral column increased curvature, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
retinal outer plexiform layer decreased thickness, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
photoreceptor outer segment layer area density, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
visual perception decreased process quality, abnormal cfap20ua5025/ua5025 (AB) lighting conditions Fig. 7 with image from Chrystal et al., 2022
retinal photoreceptor layer apoptotic process increased process quality, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
pronephric duct cystic, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
vertebral column rotational curvature, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
vertebral column asymmetrically curved, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
retinal cone cell decreased length, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
determination of heart left/right asymmetry decreased process quality, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
retinal cone cell disorganized, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
post-vent region curved, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 2 with image from Chrystal et al., 2022
retinal rod cell decreased length, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
photoreceptor outer segment layer morphology, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
visual perception decreased process quality, abnormal cfap20ua5025/ua5025 (AB) lighting conditions Fig. 7 with image from Chrystal et al., 2022
retinal photoreceptor layer ab5-casp3 labeling increased distribution, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
retinal photoreceptor layer decreased thickness, abnormal cfap20ua5025/ua5025 (AB) standard conditions Fig. 7 with image from Chrystal et al., 2022
retinal cone cell decreased length, abnormal cfap20ua5025/ua5025; kj9Tg (AB) standard conditions Fig. S10 from Chrystal et al., 2022
Citations