CRISPR

CRISPR4-kars1

ID
ZDB-CRISPR-230602-2
Name
CRISPR4-kars1
Previous Names
None
Target
Sequence
5' - GGTGGTCTCCAGGCTGAAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "Gs were added.
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 7
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
omf3 kars1
Expression
Gene expression in Wild Types + CRISPR4-kars1
No data available
Phenotype
Phenotype resulting from CRISPR4-kars1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-kars1
Phenotype Fish Conditions Figures
head decreased size, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
eye decreased size, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
pericardium edematous, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
otic vesicle decreased size, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
whole organism dead, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
swim bladder uninflated, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
whole organism kars1 expression decreased amount, abnormal kars1omf3/omf3 (NHGRI-1) standard conditions Fig. S6 from Lin et al., 2021
brain spongy, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
retina layer formation disrupted, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
head decreased size, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
brain vacuolated, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
eye decreased size, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
whole organism viability, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
eye decreased volume, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
retina morphology, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
head size, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
whole organism viability, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
retina morphology, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
eye size, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
brain structure, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
Citations