CRISPR

CRISPR1-oxr1b

ID

ZDB-CRISPR-230407-1

Name

CRISPR1-oxr1b

Previous Names

None

Target

oxr1b (1)

Sequence

5' - GAGAGGACTGATGGGGCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "GGG" at the 3' end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
cq206	oxr1b

Expression

Gene expression in Wild Types + CRISPR1-oxr1b

No data available

Phenotype

Phenotype resulting from CRISPR1-oxr1b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-oxr1b

Phenotype	Fish	Conditions	Figures
whole organism casp6a expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
whole organism casp8 expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
whole organism fas expression decreased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
olfactory bulb apoptotic process increased process quality, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 6 from Xu et al., 2021
whole organism baxb expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
whole organism sod1 expression decreased amount, abnormal	oxr1b^cq206/cq206 (AB)	standard conditions	Fig. 6 from Xu et al., 2021
whole organism dead, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 6 from Xu et al., 2021
whole organism baxa expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
whole organism casp9 expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
whole organism gpx4b expression decreased amount, abnormal	oxr1b^cq206/cq206 (AB)	standard conditions	Fig. 6 from Xu et al., 2021
whole organism oxr1b expression absent, abnormal	oxr1b^cq206/cq206 (AB)	standard conditions	Fig. 6 from Xu et al., 2021
whole organism sod3b expression decreased amount, abnormal	oxr1b^cq206/cq206 (AB)	standard conditions	Fig. 6 from Xu et al., 2021
gill apoptotic process increased process quality, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 6 from Xu et al., 2021
ventral mandibular arch apoptotic process increased process quality, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 6 from Xu et al., 2021
whole organism casp3b expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021
trunk apoptotic process increased process quality, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 6 from Xu et al., 2021
whole organism viability, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 6 from Xu et al., 2021
whole organism gpx4a expression decreased amount, abnormal	oxr1b^cq206/cq206 (AB)	standard conditions	Fig. 6 from Xu et al., 2021
whole organism bida expression increased amount, abnormal	oxr1b^cq206/cq206 (AB)	chemical treatment by environment: hydrogen peroxide	Fig. 11 from Xu et al., 2021

Citations